ID: 1076604502

View in Genome Browser
Species Human (GRCh38)
Location 10:131680786-131680808
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076604496_1076604502 30 Left 1076604496 10:131680733-131680755 CCAACTCAGATCACGGATTCACG No data
Right 1076604502 10:131680786-131680808 GATCATGGATTCACAGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076604502 Original CRISPR GATCATGGATTCACAGTTAT GGG Intergenic
No off target data available for this crispr