ID: 1076605006

View in Genome Browser
Species Human (GRCh38)
Location 10:131683639-131683661
Sequence CATCTCCGTGGAAGGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076605006_1076605014 -10 Left 1076605006 10:131683639-131683661 CCAGGTCCCCTTCCACGGAGATG No data
Right 1076605014 10:131683652-131683674 CACGGAGATGGGGACACCGCAGG No data
1076605006_1076605018 27 Left 1076605006 10:131683639-131683661 CCAGGTCCCCTTCCACGGAGATG No data
Right 1076605018 10:131683689-131683711 GCAGACACGACCTGCCTTCCCGG No data
1076605006_1076605019 28 Left 1076605006 10:131683639-131683661 CCAGGTCCCCTTCCACGGAGATG No data
Right 1076605019 10:131683690-131683712 CAGACACGACCTGCCTTCCCGGG No data
1076605006_1076605015 -7 Left 1076605006 10:131683639-131683661 CCAGGTCCCCTTCCACGGAGATG No data
Right 1076605015 10:131683655-131683677 GGAGATGGGGACACCGCAGGAGG No data
1076605006_1076605016 5 Left 1076605006 10:131683639-131683661 CCAGGTCCCCTTCCACGGAGATG No data
Right 1076605016 10:131683667-131683689 ACCGCAGGAGGCACTGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076605006 Original CRISPR CATCTCCGTGGAAGGGGACC TGG (reversed) Intergenic
No off target data available for this crispr