ID: 1076606843

View in Genome Browser
Species Human (GRCh38)
Location 10:131694865-131694887
Sequence GTGGCCACACAGCTCCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076606843_1076606849 1 Left 1076606843 10:131694865-131694887 CCCAGAAGGAGCTGTGTGGCCAC No data
Right 1076606849 10:131694889-131694911 TAGCCAGCCGGACACCAGGGTGG No data
1076606843_1076606848 -2 Left 1076606843 10:131694865-131694887 CCCAGAAGGAGCTGTGTGGCCAC No data
Right 1076606848 10:131694886-131694908 ACTTAGCCAGCCGGACACCAGGG No data
1076606843_1076606855 20 Left 1076606843 10:131694865-131694887 CCCAGAAGGAGCTGTGTGGCCAC No data
Right 1076606855 10:131694908-131694930 GTGGGGTCCCCAGACATTCAAGG No data
1076606843_1076606851 3 Left 1076606843 10:131694865-131694887 CCCAGAAGGAGCTGTGTGGCCAC No data
Right 1076606851 10:131694891-131694913 GCCAGCCGGACACCAGGGTGGGG No data
1076606843_1076606850 2 Left 1076606843 10:131694865-131694887 CCCAGAAGGAGCTGTGTGGCCAC No data
Right 1076606850 10:131694890-131694912 AGCCAGCCGGACACCAGGGTGGG No data
1076606843_1076606847 -3 Left 1076606843 10:131694865-131694887 CCCAGAAGGAGCTGTGTGGCCAC No data
Right 1076606847 10:131694885-131694907 CACTTAGCCAGCCGGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076606843 Original CRISPR GTGGCCACACAGCTCCTTCT GGG (reversed) Intergenic
No off target data available for this crispr