ID: 1076607769

View in Genome Browser
Species Human (GRCh38)
Location 10:131700622-131700644
Sequence CAGGACTGCCTGGGTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076607769_1076607773 -9 Left 1076607769 10:131700622-131700644 CCAGTTGCACCCAGGCAGTCCTG No data
Right 1076607773 10:131700636-131700658 GCAGTCCTGCCCACGTGGAGAGG No data
1076607769_1076607775 -3 Left 1076607769 10:131700622-131700644 CCAGTTGCACCCAGGCAGTCCTG No data
Right 1076607775 10:131700642-131700664 CTGCCCACGTGGAGAGGTCCTGG No data
1076607769_1076607779 14 Left 1076607769 10:131700622-131700644 CCAGTTGCACCCAGGCAGTCCTG No data
Right 1076607779 10:131700659-131700681 TCCTGGGCAAACCCTGTCTCTGG No data
1076607769_1076607781 17 Left 1076607769 10:131700622-131700644 CCAGTTGCACCCAGGCAGTCCTG No data
Right 1076607781 10:131700662-131700684 TGGGCAAACCCTGTCTCTGGAGG No data
1076607769_1076607776 -2 Left 1076607769 10:131700622-131700644 CCAGTTGCACCCAGGCAGTCCTG No data
Right 1076607776 10:131700643-131700665 TGCCCACGTGGAGAGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076607769 Original CRISPR CAGGACTGCCTGGGTGCAAC TGG (reversed) Intergenic
No off target data available for this crispr