ID: 1076607963

View in Genome Browser
Species Human (GRCh38)
Location 10:131701613-131701635
Sequence TCTCCTCACTGGTGTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076607963_1076607967 14 Left 1076607963 10:131701613-131701635 CCATCAGGACACCAGTGAGGAGA No data
Right 1076607967 10:131701650-131701672 GTATCTGGCTGTGAGCCCAGTGG No data
1076607963_1076607969 25 Left 1076607963 10:131701613-131701635 CCATCAGGACACCAGTGAGGAGA No data
Right 1076607969 10:131701661-131701683 TGAGCCCAGTGGAGCCCAGTGGG No data
1076607963_1076607966 -1 Left 1076607963 10:131701613-131701635 CCATCAGGACACCAGTGAGGAGA No data
Right 1076607966 10:131701635-131701657 AGCTGGTGAGACTCTGTATCTGG No data
1076607963_1076607968 24 Left 1076607963 10:131701613-131701635 CCATCAGGACACCAGTGAGGAGA No data
Right 1076607968 10:131701660-131701682 GTGAGCCCAGTGGAGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076607963 Original CRISPR TCTCCTCACTGGTGTCCTGA TGG (reversed) Intergenic
No off target data available for this crispr