ID: 1076610416

View in Genome Browser
Species Human (GRCh38)
Location 10:131722704-131722726
Sequence CATCAGCACCCGAGGCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076610416_1076610423 -5 Left 1076610416 10:131722704-131722726 CCGCAGAGCCTCGGGTGCTGATG No data
Right 1076610423 10:131722722-131722744 TGATGGGCCACAGGCGAGGGTGG No data
1076610416_1076610427 28 Left 1076610416 10:131722704-131722726 CCGCAGAGCCTCGGGTGCTGATG No data
Right 1076610427 10:131722755-131722777 GCACTTTCCACATCCAGACCAGG No data
1076610416_1076610421 -9 Left 1076610416 10:131722704-131722726 CCGCAGAGCCTCGGGTGCTGATG No data
Right 1076610421 10:131722718-131722740 GTGCTGATGGGCCACAGGCGAGG No data
1076610416_1076610422 -8 Left 1076610416 10:131722704-131722726 CCGCAGAGCCTCGGGTGCTGATG No data
Right 1076610422 10:131722719-131722741 TGCTGATGGGCCACAGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076610416 Original CRISPR CATCAGCACCCGAGGCTCTG CGG (reversed) Intergenic
No off target data available for this crispr