ID: 1076611345

View in Genome Browser
Species Human (GRCh38)
Location 10:131727724-131727746
Sequence GGCTCCCCAGAGCCACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076611338_1076611345 29 Left 1076611338 10:131727672-131727694 CCACAGAGCGGGCTGTGGACAAA No data
Right 1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG No data
1076611339_1076611345 1 Left 1076611339 10:131727700-131727722 CCTTCTGTCACACGCCCCAGTCC No data
Right 1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076611345 Original CRISPR GGCTCCCCAGAGCCACCTGA AGG Intergenic
No off target data available for this crispr