ID: 1076611645

View in Genome Browser
Species Human (GRCh38)
Location 10:131729667-131729689
Sequence TAGGATTGTCTGTGGATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076611645_1076611649 14 Left 1076611645 10:131729667-131729689 CCTGTTATCCACAGACAATCCTA No data
Right 1076611649 10:131729704-131729726 TAAACATTGTTTGCATTCTTGGG No data
1076611645_1076611648 13 Left 1076611645 10:131729667-131729689 CCTGTTATCCACAGACAATCCTA No data
Right 1076611648 10:131729703-131729725 ATAAACATTGTTTGCATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076611645 Original CRISPR TAGGATTGTCTGTGGATAAC AGG (reversed) Intergenic
No off target data available for this crispr