ID: 1076613607

View in Genome Browser
Species Human (GRCh38)
Location 10:131742519-131742541
Sequence TGTGCGATGCTGCAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076613607_1076613616 11 Left 1076613607 10:131742519-131742541 CCTCCCACCTGCAGCATCGCACA No data
Right 1076613616 10:131742553-131742575 CCTCGGCACTGAGTGACCCTCGG No data
1076613607_1076613619 28 Left 1076613607 10:131742519-131742541 CCTCCCACCTGCAGCATCGCACA No data
Right 1076613619 10:131742570-131742592 CCTCGGCACTGAGTGACCCTCGG No data
1076613607_1076613614 -6 Left 1076613607 10:131742519-131742541 CCTCCCACCTGCAGCATCGCACA No data
Right 1076613614 10:131742536-131742558 CGCACAGGCACAGGGATCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076613607 Original CRISPR TGTGCGATGCTGCAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr