ID: 1076620071

View in Genome Browser
Species Human (GRCh38)
Location 10:131781341-131781363
Sequence CAGGCACAACAGAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076620060_1076620071 16 Left 1076620060 10:131781302-131781324 CCAGCAATCCCAGCTGTCCTGCT No data
Right 1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG No data
1076620065_1076620071 7 Left 1076620065 10:131781311-131781333 CCAGCTGTCCTGCTCAGGGGCCT No data
Right 1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG No data
1076620064_1076620071 8 Left 1076620064 10:131781310-131781332 CCCAGCTGTCCTGCTCAGGGGCC No data
Right 1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG No data
1076620066_1076620071 -1 Left 1076620066 10:131781319-131781341 CCTGCTCAGGGGCCTTCAGTAGC No data
Right 1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076620071 Original CRISPR CAGGCACAACAGAGGGATGC AGG Intergenic
No off target data available for this crispr