ID: 1076620155

View in Genome Browser
Species Human (GRCh38)
Location 10:131781927-131781949
Sequence GTGAACTCCAGCACCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076620155_1076620165 7 Left 1076620155 10:131781927-131781949 CCAGCCCAGGTGCTGGAGTTCAC No data
Right 1076620165 10:131781957-131781979 CATGGCCTTGGCCTGGCCCTGGG No data
1076620155_1076620162 0 Left 1076620155 10:131781927-131781949 CCAGCCCAGGTGCTGGAGTTCAC No data
Right 1076620162 10:131781950-131781972 TGGGAACCATGGCCTTGGCCTGG No data
1076620155_1076620164 6 Left 1076620155 10:131781927-131781949 CCAGCCCAGGTGCTGGAGTTCAC No data
Right 1076620164 10:131781956-131781978 CCATGGCCTTGGCCTGGCCCTGG No data
1076620155_1076620161 -5 Left 1076620155 10:131781927-131781949 CCAGCCCAGGTGCTGGAGTTCAC No data
Right 1076620161 10:131781945-131781967 TTCACTGGGAACCATGGCCTTGG No data
1076620155_1076620168 20 Left 1076620155 10:131781927-131781949 CCAGCCCAGGTGCTGGAGTTCAC No data
Right 1076620168 10:131781970-131781992 TGGCCCTGGGAGCTGTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076620155 Original CRISPR GTGAACTCCAGCACCTGGGC TGG (reversed) Intergenic
No off target data available for this crispr