ID: 1076620163

View in Genome Browser
Species Human (GRCh38)
Location 10:131781956-131781978
Sequence CCAGGGCCAGGCCAAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076620163_1076620168 -9 Left 1076620163 10:131781956-131781978 CCATGGCCTTGGCCTGGCCCTGG No data
Right 1076620168 10:131781970-131781992 TGGCCCTGGGAGCTGTGAGTTGG No data
1076620163_1076620171 6 Left 1076620163 10:131781956-131781978 CCATGGCCTTGGCCTGGCCCTGG No data
Right 1076620171 10:131781985-131782007 TGAGTTGGTGTGAGTAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076620163 Original CRISPR CCAGGGCCAGGCCAAGGCCA TGG (reversed) Intergenic
No off target data available for this crispr