ID: 1076620166

View in Genome Browser
Species Human (GRCh38)
Location 10:131781962-131781984
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076620166_1076620171 0 Left 1076620166 10:131781962-131781984 CCTTGGCCTGGCCCTGGGAGCTG No data
Right 1076620171 10:131781985-131782007 TGAGTTGGTGTGAGTAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076620166 Original CRISPR CAGCTCCCAGGGCCAGGCCA AGG (reversed) Intergenic
No off target data available for this crispr