ID: 1076620167

View in Genome Browser
Species Human (GRCh38)
Location 10:131781968-131781990
Sequence AACTCACAGCTCCCAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076620167_1076620171 -6 Left 1076620167 10:131781968-131781990 CCTGGCCCTGGGAGCTGTGAGTT No data
Right 1076620171 10:131781985-131782007 TGAGTTGGTGTGAGTAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076620167 Original CRISPR AACTCACAGCTCCCAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr