ID: 1076620171

View in Genome Browser
Species Human (GRCh38)
Location 10:131781985-131782007
Sequence TGAGTTGGTGTGAGTAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076620159_1076620171 30 Left 1076620159 10:131781932-131781954 CCAGGTGCTGGAGTTCACTGGGA No data
Right 1076620171 10:131781985-131782007 TGAGTTGGTGTGAGTAGCTATGG No data
1076620167_1076620171 -6 Left 1076620167 10:131781968-131781990 CCTGGCCCTGGGAGCTGTGAGTT No data
Right 1076620171 10:131781985-131782007 TGAGTTGGTGTGAGTAGCTATGG No data
1076620163_1076620171 6 Left 1076620163 10:131781956-131781978 CCATGGCCTTGGCCTGGCCCTGG No data
Right 1076620171 10:131781985-131782007 TGAGTTGGTGTGAGTAGCTATGG No data
1076620166_1076620171 0 Left 1076620166 10:131781962-131781984 CCTTGGCCTGGCCCTGGGAGCTG No data
Right 1076620171 10:131781985-131782007 TGAGTTGGTGTGAGTAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076620171 Original CRISPR TGAGTTGGTGTGAGTAGCTA TGG Intergenic
No off target data available for this crispr