ID: 1076622577

View in Genome Browser
Species Human (GRCh38)
Location 10:131801702-131801724
Sequence GTGGATACAGAGAGGCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076622577_1076622583 16 Left 1076622577 10:131801702-131801724 CCCATAGGCCTCTCTGTATCCAC No data
Right 1076622583 10:131801741-131801763 ACCACACATCCACAAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076622577 Original CRISPR GTGGATACAGAGAGGCCTAT GGG (reversed) Intergenic
No off target data available for this crispr