ID: 1076622637

View in Genome Browser
Species Human (GRCh38)
Location 10:131802328-131802350
Sequence CAGTACCCACTGATGGCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076622634_1076622637 8 Left 1076622634 10:131802297-131802319 CCATCGGGTTGGCCGGAACTGAA No data
Right 1076622637 10:131802328-131802350 CAGTACCCACTGATGGCTCGAGG No data
1076622635_1076622637 -4 Left 1076622635 10:131802309-131802331 CCGGAACTGAAGCAAGCGTCAGT No data
Right 1076622637 10:131802328-131802350 CAGTACCCACTGATGGCTCGAGG No data
1076622632_1076622637 18 Left 1076622632 10:131802287-131802309 CCATTTCACGCCATCGGGTTGGC No data
Right 1076622637 10:131802328-131802350 CAGTACCCACTGATGGCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076622637 Original CRISPR CAGTACCCACTGATGGCTCG AGG Intergenic
No off target data available for this crispr