ID: 1076623044

View in Genome Browser
Species Human (GRCh38)
Location 10:131805092-131805114
Sequence ATCCTCGGCCCCGGCTTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076623044_1076623049 -3 Left 1076623044 10:131805092-131805114 CCCCGGAAGCCGGGGCCGAGGAT No data
Right 1076623049 10:131805112-131805134 GATCAGAGAAGTGAGTGCTGAGG No data
1076623044_1076623052 17 Left 1076623044 10:131805092-131805114 CCCCGGAAGCCGGGGCCGAGGAT No data
Right 1076623052 10:131805132-131805154 AGGTCTCACGGGCCCCCAAGCGG No data
1076623044_1076623050 5 Left 1076623044 10:131805092-131805114 CCCCGGAAGCCGGGGCCGAGGAT No data
Right 1076623050 10:131805120-131805142 AAGTGAGTGCTGAGGTCTCACGG No data
1076623044_1076623054 19 Left 1076623044 10:131805092-131805114 CCCCGGAAGCCGGGGCCGAGGAT No data
Right 1076623054 10:131805134-131805156 GTCTCACGGGCCCCCAAGCGGGG No data
1076623044_1076623055 26 Left 1076623044 10:131805092-131805114 CCCCGGAAGCCGGGGCCGAGGAT No data
Right 1076623055 10:131805141-131805163 GGGCCCCCAAGCGGGGTCGCAGG No data
1076623044_1076623053 18 Left 1076623044 10:131805092-131805114 CCCCGGAAGCCGGGGCCGAGGAT No data
Right 1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG No data
1076623044_1076623051 6 Left 1076623044 10:131805092-131805114 CCCCGGAAGCCGGGGCCGAGGAT No data
Right 1076623051 10:131805121-131805143 AGTGAGTGCTGAGGTCTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076623044 Original CRISPR ATCCTCGGCCCCGGCTTCCG GGG (reversed) Intergenic
No off target data available for this crispr