ID: 1076623048

View in Genome Browser
Species Human (GRCh38)
Location 10:131805107-131805129
Sequence GCACTCACTTCTCTGATCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076623048_1076623055 11 Left 1076623048 10:131805107-131805129 CCGAGGATCAGAGAAGTGAGTGC No data
Right 1076623055 10:131805141-131805163 GGGCCCCCAAGCGGGGTCGCAGG No data
1076623048_1076623053 3 Left 1076623048 10:131805107-131805129 CCGAGGATCAGAGAAGTGAGTGC No data
Right 1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG No data
1076623048_1076623054 4 Left 1076623048 10:131805107-131805129 CCGAGGATCAGAGAAGTGAGTGC No data
Right 1076623054 10:131805134-131805156 GTCTCACGGGCCCCCAAGCGGGG No data
1076623048_1076623050 -10 Left 1076623048 10:131805107-131805129 CCGAGGATCAGAGAAGTGAGTGC No data
Right 1076623050 10:131805120-131805142 AAGTGAGTGCTGAGGTCTCACGG No data
1076623048_1076623051 -9 Left 1076623048 10:131805107-131805129 CCGAGGATCAGAGAAGTGAGTGC No data
Right 1076623051 10:131805121-131805143 AGTGAGTGCTGAGGTCTCACGGG No data
1076623048_1076623052 2 Left 1076623048 10:131805107-131805129 CCGAGGATCAGAGAAGTGAGTGC No data
Right 1076623052 10:131805132-131805154 AGGTCTCACGGGCCCCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076623048 Original CRISPR GCACTCACTTCTCTGATCCT CGG (reversed) Intergenic
No off target data available for this crispr