ID: 1076623053

View in Genome Browser
Species Human (GRCh38)
Location 10:131805133-131805155
Sequence GGTCTCACGGGCCCCCAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076623045_1076623053 17 Left 1076623045 10:131805093-131805115 CCCGGAAGCCGGGGCCGAGGATC No data
Right 1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG No data
1076623048_1076623053 3 Left 1076623048 10:131805107-131805129 CCGAGGATCAGAGAAGTGAGTGC No data
Right 1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG No data
1076623046_1076623053 16 Left 1076623046 10:131805094-131805116 CCGGAAGCCGGGGCCGAGGATCA No data
Right 1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG No data
1076623044_1076623053 18 Left 1076623044 10:131805092-131805114 CCCCGGAAGCCGGGGCCGAGGAT No data
Right 1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG No data
1076623047_1076623053 9 Left 1076623047 10:131805101-131805123 CCGGGGCCGAGGATCAGAGAAGT No data
Right 1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076623053 Original CRISPR GGTCTCACGGGCCCCCAAGC GGG Intergenic
No off target data available for this crispr