ID: 1076623068

View in Genome Browser
Species Human (GRCh38)
Location 10:131805209-131805231
Sequence TTGTTATTATTAAGGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076623061_1076623068 5 Left 1076623061 10:131805181-131805203 CCAACCACCCACGCCACTTTGGA No data
Right 1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG No data
1076623065_1076623068 -8 Left 1076623065 10:131805194-131805216 CCACTTTGGACTTCTTTGTTATT No data
Right 1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG No data
1076623064_1076623068 -3 Left 1076623064 10:131805189-131805211 CCACGCCACTTTGGACTTCTTTG No data
Right 1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG No data
1076623062_1076623068 1 Left 1076623062 10:131805185-131805207 CCACCCACGCCACTTTGGACTTC No data
Right 1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG No data
1076623063_1076623068 -2 Left 1076623063 10:131805188-131805210 CCCACGCCACTTTGGACTTCTTT No data
Right 1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076623068 Original CRISPR TTGTTATTATTAAGGATAAA GGG Intergenic
No off target data available for this crispr