ID: 1076623617

View in Genome Browser
Species Human (GRCh38)
Location 10:131808548-131808570
Sequence CTGAGGCTGGGCATAGATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076623617_1076623626 17 Left 1076623617 10:131808548-131808570 CCGAGATCTATGCCCAGCCTCAG No data
Right 1076623626 10:131808588-131808610 AATCTATTCACATCTCGTCCTGG No data
1076623617_1076623622 -7 Left 1076623617 10:131808548-131808570 CCGAGATCTATGCCCAGCCTCAG No data
Right 1076623622 10:131808564-131808586 GCCTCAGAGAGCAAAGGGCCAGG No data
1076623617_1076623624 -6 Left 1076623617 10:131808548-131808570 CCGAGATCTATGCCCAGCCTCAG No data
Right 1076623624 10:131808565-131808587 CCTCAGAGAGCAAAGGGCCAGGG No data
1076623617_1076623628 19 Left 1076623617 10:131808548-131808570 CCGAGATCTATGCCCAGCCTCAG No data
Right 1076623628 10:131808590-131808612 TCTATTCACATCTCGTCCTGGGG No data
1076623617_1076623627 18 Left 1076623617 10:131808548-131808570 CCGAGATCTATGCCCAGCCTCAG No data
Right 1076623627 10:131808589-131808611 ATCTATTCACATCTCGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076623617 Original CRISPR CTGAGGCTGGGCATAGATCT CGG (reversed) Intergenic
No off target data available for this crispr