ID: 1076625143

View in Genome Browser
Species Human (GRCh38)
Location 10:131817092-131817114
Sequence GAGCTATGCTTGACTGCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076625140_1076625143 6 Left 1076625140 10:131817063-131817085 CCCCTGAAGGCTGCTCGCGGTTC No data
Right 1076625143 10:131817092-131817114 GAGCTATGCTTGACTGCTTCCGG No data
1076625141_1076625143 5 Left 1076625141 10:131817064-131817086 CCCTGAAGGCTGCTCGCGGTTCA No data
Right 1076625143 10:131817092-131817114 GAGCTATGCTTGACTGCTTCCGG No data
1076625136_1076625143 27 Left 1076625136 10:131817042-131817064 CCATTAGTCCAGAAACTGCAGCC No data
Right 1076625143 10:131817092-131817114 GAGCTATGCTTGACTGCTTCCGG No data
1076625142_1076625143 4 Left 1076625142 10:131817065-131817087 CCTGAAGGCTGCTCGCGGTTCAA No data
Right 1076625143 10:131817092-131817114 GAGCTATGCTTGACTGCTTCCGG No data
1076625137_1076625143 19 Left 1076625137 10:131817050-131817072 CCAGAAACTGCAGCCCCTGAAGG No data
Right 1076625143 10:131817092-131817114 GAGCTATGCTTGACTGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076625143 Original CRISPR GAGCTATGCTTGACTGCTTC CGG Intergenic
No off target data available for this crispr