ID: 1076630169

View in Genome Browser
Species Human (GRCh38)
Location 10:131847569-131847591
Sequence GCCTTTGCCTGGCCCTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076630169_1076630176 -3 Left 1076630169 10:131847569-131847591 CCATGGAAGGGCCAGGCAAAGGC No data
Right 1076630176 10:131847589-131847611 GGCCGAGGCCAGGGAGGGACAGG No data
1076630169_1076630174 -9 Left 1076630169 10:131847569-131847591 CCATGGAAGGGCCAGGCAAAGGC No data
Right 1076630174 10:131847583-131847605 GGCAAAGGCCGAGGCCAGGGAGG No data
1076630169_1076630179 25 Left 1076630169 10:131847569-131847591 CCATGGAAGGGCCAGGCAAAGGC No data
Right 1076630179 10:131847617-131847639 TCCTTCCTGCATCCCCCACATGG No data
1076630169_1076630175 -8 Left 1076630169 10:131847569-131847591 CCATGGAAGGGCCAGGCAAAGGC No data
Right 1076630175 10:131847584-131847606 GCAAAGGCCGAGGCCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076630169 Original CRISPR GCCTTTGCCTGGCCCTTCCA TGG (reversed) Intergenic
No off target data available for this crispr