ID: 1076630176

View in Genome Browser
Species Human (GRCh38)
Location 10:131847589-131847611
Sequence GGCCGAGGCCAGGGAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076630169_1076630176 -3 Left 1076630169 10:131847569-131847591 CCATGGAAGGGCCAGGCAAAGGC No data
Right 1076630176 10:131847589-131847611 GGCCGAGGCCAGGGAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076630176 Original CRISPR GGCCGAGGCCAGGGAGGGAC AGG Intergenic
No off target data available for this crispr