ID: 1076630687

View in Genome Browser
Species Human (GRCh38)
Location 10:131850224-131850246
Sequence AAGTTAATGCAGATGGACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076630680_1076630687 9 Left 1076630680 10:131850192-131850214 CCTTGAGCGCGTGAGTCGCACCC No data
Right 1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG No data
1076630679_1076630687 30 Left 1076630679 10:131850171-131850193 CCGTGACAGAGCAGCTATTCTCC No data
Right 1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076630687 Original CRISPR AAGTTAATGCAGATGGACCT CGG Intergenic
No off target data available for this crispr