ID: 1076632211

View in Genome Browser
Species Human (GRCh38)
Location 10:131857992-131858014
Sequence CTAAGAGACCTGTTCGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076632211_1076632215 3 Left 1076632211 10:131857992-131858014 CCCATCCCGAACAGGTCTCTTAG No data
Right 1076632215 10:131858018-131858040 AGTTCATTGTCAGCGTGCAGTGG No data
1076632211_1076632217 30 Left 1076632211 10:131857992-131858014 CCCATCCCGAACAGGTCTCTTAG No data
Right 1076632217 10:131858045-131858067 GAGCCTGCCTCTGACTGAGGCGG No data
1076632211_1076632216 27 Left 1076632211 10:131857992-131858014 CCCATCCCGAACAGGTCTCTTAG No data
Right 1076632216 10:131858042-131858064 TCAGAGCCTGCCTCTGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076632211 Original CRISPR CTAAGAGACCTGTTCGGGAT GGG (reversed) Intergenic
No off target data available for this crispr