ID: 1076634568

View in Genome Browser
Species Human (GRCh38)
Location 10:131873959-131873981
Sequence CTTCTGGGGTGGGCGTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634568_1076634578 18 Left 1076634568 10:131873959-131873981 CCCAACCACGCCCACCCCAGAAG No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634568 Original CRISPR CTTCTGGGGTGGGCGTGGTT GGG (reversed) Intergenic