ID: 1076634571

View in Genome Browser
Species Human (GRCh38)
Location 10:131873964-131873986
Sequence TTTTCCTTCTGGGGTGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634571_1076634580 29 Left 1076634571 10:131873964-131873986 CCACGCCCACCCCAGAAGGAAAA No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634571_1076634578 13 Left 1076634571 10:131873964-131873986 CCACGCCCACCCCAGAAGGAAAA No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634571_1076634581 30 Left 1076634571 10:131873964-131873986 CCACGCCCACCCCAGAAGGAAAA No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634571 Original CRISPR TTTTCCTTCTGGGGTGGGCG TGG (reversed) Intergenic