ID: 1076634572

View in Genome Browser
Species Human (GRCh38)
Location 10:131873969-131873991
Sequence AGGCATTTTCCTTCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634572_1076634578 8 Left 1076634572 10:131873969-131873991 CCCACCCCAGAAGGAAAATGCCT No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634572_1076634581 25 Left 1076634572 10:131873969-131873991 CCCACCCCAGAAGGAAAATGCCT No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634572_1076634580 24 Left 1076634572 10:131873969-131873991 CCCACCCCAGAAGGAAAATGCCT No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634572 Original CRISPR AGGCATTTTCCTTCTGGGGT GGG (reversed) Intergenic