ID: 1076634573

View in Genome Browser
Species Human (GRCh38)
Location 10:131873970-131873992
Sequence GAGGCATTTTCCTTCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634573_1076634581 24 Left 1076634573 10:131873970-131873992 CCACCCCAGAAGGAAAATGCCTC No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634573_1076634580 23 Left 1076634573 10:131873970-131873992 CCACCCCAGAAGGAAAATGCCTC No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634573_1076634578 7 Left 1076634573 10:131873970-131873992 CCACCCCAGAAGGAAAATGCCTC No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634573_1076634582 30 Left 1076634573 10:131873970-131873992 CCACCCCAGAAGGAAAATGCCTC No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634573 Original CRISPR GAGGCATTTTCCTTCTGGGG TGG (reversed) Intergenic
No off target data available for this crispr