ID: 1076634574

View in Genome Browser
Species Human (GRCh38)
Location 10:131873973-131873995
Sequence ACTGAGGCATTTTCCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634574_1076634578 4 Left 1076634574 10:131873973-131873995 CCCCAGAAGGAAAATGCCTCAGT No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634574_1076634581 21 Left 1076634574 10:131873973-131873995 CCCCAGAAGGAAAATGCCTCAGT No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634574_1076634582 27 Left 1076634574 10:131873973-131873995 CCCCAGAAGGAAAATGCCTCAGT No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data
1076634574_1076634580 20 Left 1076634574 10:131873973-131873995 CCCCAGAAGGAAAATGCCTCAGT No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634574 Original CRISPR ACTGAGGCATTTTCCTTCTG GGG (reversed) Intergenic