ID: 1076634575

View in Genome Browser
Species Human (GRCh38)
Location 10:131873974-131873996
Sequence CACTGAGGCATTTTCCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634575_1076634581 20 Left 1076634575 10:131873974-131873996 CCCAGAAGGAAAATGCCTCAGTG No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634575_1076634578 3 Left 1076634575 10:131873974-131873996 CCCAGAAGGAAAATGCCTCAGTG No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634575_1076634580 19 Left 1076634575 10:131873974-131873996 CCCAGAAGGAAAATGCCTCAGTG No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634575_1076634582 26 Left 1076634575 10:131873974-131873996 CCCAGAAGGAAAATGCCTCAGTG No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634575 Original CRISPR CACTGAGGCATTTTCCTTCT GGG (reversed) Intergenic