ID: 1076634578

View in Genome Browser
Species Human (GRCh38)
Location 10:131874000-131874022
Sequence CTTTCCTCTGTGCTAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634575_1076634578 3 Left 1076634575 10:131873974-131873996 CCCAGAAGGAAAATGCCTCAGTG No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634569_1076634578 17 Left 1076634569 10:131873960-131873982 CCAACCACGCCCACCCCAGAAGG No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634568_1076634578 18 Left 1076634568 10:131873959-131873981 CCCAACCACGCCCACCCCAGAAG No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634571_1076634578 13 Left 1076634571 10:131873964-131873986 CCACGCCCACCCCAGAAGGAAAA No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634573_1076634578 7 Left 1076634573 10:131873970-131873992 CCACCCCAGAAGGAAAATGCCTC No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634574_1076634578 4 Left 1076634574 10:131873973-131873995 CCCCAGAAGGAAAATGCCTCAGT No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634576_1076634578 2 Left 1076634576 10:131873975-131873997 CCAGAAGGAAAATGCCTCAGTGT No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data
1076634572_1076634578 8 Left 1076634572 10:131873969-131873991 CCCACCCCAGAAGGAAAATGCCT No data
Right 1076634578 10:131874000-131874022 CTTTCCTCTGTGCTAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634578 Original CRISPR CTTTCCTCTGTGCTAGAAAA TGG Intergenic