ID: 1076634580

View in Genome Browser
Species Human (GRCh38)
Location 10:131874016-131874038
Sequence AAAATGGCTTTGTTTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634576_1076634580 18 Left 1076634576 10:131873975-131873997 CCAGAAGGAAAATGCCTCAGTGT No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634575_1076634580 19 Left 1076634575 10:131873974-131873996 CCCAGAAGGAAAATGCCTCAGTG No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634571_1076634580 29 Left 1076634571 10:131873964-131873986 CCACGCCCACCCCAGAAGGAAAA No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634572_1076634580 24 Left 1076634572 10:131873969-131873991 CCCACCCCAGAAGGAAAATGCCT No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634573_1076634580 23 Left 1076634573 10:131873970-131873992 CCACCCCAGAAGGAAAATGCCTC No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634577_1076634580 4 Left 1076634577 10:131873989-131874011 CCTCAGTGTCTCTTTCCTCTGTG No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data
1076634574_1076634580 20 Left 1076634574 10:131873973-131873995 CCCCAGAAGGAAAATGCCTCAGT No data
Right 1076634580 10:131874016-131874038 AAAATGGCTTTGTTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634580 Original CRISPR AAAATGGCTTTGTTTCCCTC AGG Intergenic
No off target data available for this crispr