ID: 1076634581

View in Genome Browser
Species Human (GRCh38)
Location 10:131874017-131874039
Sequence AAATGGCTTTGTTTCCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634571_1076634581 30 Left 1076634571 10:131873964-131873986 CCACGCCCACCCCAGAAGGAAAA No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634576_1076634581 19 Left 1076634576 10:131873975-131873997 CCAGAAGGAAAATGCCTCAGTGT No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634573_1076634581 24 Left 1076634573 10:131873970-131873992 CCACCCCAGAAGGAAAATGCCTC No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634579_1076634581 -10 Left 1076634579 10:131874004-131874026 CCTCTGTGCTAGAAAATGGCTTT No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634574_1076634581 21 Left 1076634574 10:131873973-131873995 CCCCAGAAGGAAAATGCCTCAGT No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634572_1076634581 25 Left 1076634572 10:131873969-131873991 CCCACCCCAGAAGGAAAATGCCT No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634577_1076634581 5 Left 1076634577 10:131873989-131874011 CCTCAGTGTCTCTTTCCTCTGTG No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data
1076634575_1076634581 20 Left 1076634575 10:131873974-131873996 CCCAGAAGGAAAATGCCTCAGTG No data
Right 1076634581 10:131874017-131874039 AAATGGCTTTGTTTCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634581 Original CRISPR AAATGGCTTTGTTTCCCTCA GGG Intergenic