ID: 1076634582

View in Genome Browser
Species Human (GRCh38)
Location 10:131874023-131874045
Sequence CTTTGTTTCCCTCAGGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076634577_1076634582 11 Left 1076634577 10:131873989-131874011 CCTCAGTGTCTCTTTCCTCTGTG No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data
1076634574_1076634582 27 Left 1076634574 10:131873973-131873995 CCCCAGAAGGAAAATGCCTCAGT No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data
1076634573_1076634582 30 Left 1076634573 10:131873970-131873992 CCACCCCAGAAGGAAAATGCCTC No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data
1076634575_1076634582 26 Left 1076634575 10:131873974-131873996 CCCAGAAGGAAAATGCCTCAGTG No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data
1076634579_1076634582 -4 Left 1076634579 10:131874004-131874026 CCTCTGTGCTAGAAAATGGCTTT No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data
1076634576_1076634582 25 Left 1076634576 10:131873975-131873997 CCAGAAGGAAAATGCCTCAGTGT No data
Right 1076634582 10:131874023-131874045 CTTTGTTTCCCTCAGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076634582 Original CRISPR CTTTGTTTCCCTCAGGGCGC TGG Intergenic