ID: 1076636612

View in Genome Browser
Species Human (GRCh38)
Location 10:131885345-131885367
Sequence GCGCCCTGCCCCAAGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076636607_1076636612 -2 Left 1076636607 10:131885324-131885346 CCACACATCCAGGCAGCCTCCGC No data
Right 1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG No data
1076636606_1076636612 4 Left 1076636606 10:131885318-131885340 CCTGCGCCACACATCCAGGCAGC No data
Right 1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG No data
1076636608_1076636612 -10 Left 1076636608 10:131885332-131885354 CCAGGCAGCCTCCGCGCCCTGCC No data
Right 1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG No data
1076636604_1076636612 15 Left 1076636604 10:131885307-131885329 CCACGCAGGCGCCTGCGCCACAC No data
Right 1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076636612 Original CRISPR GCGCCCTGCCCCAAGTCCCT GGG Intergenic
No off target data available for this crispr