ID: 1076637304

View in Genome Browser
Species Human (GRCh38)
Location 10:131890997-131891019
Sequence CAGGAAGGGGACGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076637304_1076637310 -10 Left 1076637304 10:131890997-131891019 CCTGCAGCTGCGTCCCCTTCCTG No data
Right 1076637310 10:131891010-131891032 CCCCTTCCTGAGGAGGGCCCGGG No data
1076637304_1076637321 29 Left 1076637304 10:131890997-131891019 CCTGCAGCTGCGTCCCCTTCCTG No data
Right 1076637321 10:131891049-131891071 CTGCTCCAAGGCTCCTAAAGTGG No data
1076637304_1076637315 3 Left 1076637304 10:131890997-131891019 CCTGCAGCTGCGTCCCCTTCCTG No data
Right 1076637315 10:131891023-131891045 AGGGCCCGGGGCCTCTGCTGAGG No data
1076637304_1076637312 -9 Left 1076637304 10:131890997-131891019 CCTGCAGCTGCGTCCCCTTCCTG No data
Right 1076637312 10:131891011-131891033 CCCTTCCTGAGGAGGGCCCGGGG No data
1076637304_1076637319 17 Left 1076637304 10:131890997-131891019 CCTGCAGCTGCGTCCCCTTCCTG No data
Right 1076637319 10:131891037-131891059 CTGCTGAGGCCACTGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076637304 Original CRISPR CAGGAAGGGGACGCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr