ID: 1076637604

View in Genome Browser
Species Human (GRCh38)
Location 10:131892390-131892412
Sequence CCTCCCGGGATCGTCGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076637604_1076637606 -10 Left 1076637604 10:131892390-131892412 CCACGCACGACGATCCCGGGAGG No data
Right 1076637606 10:131892403-131892425 TCCCGGGAGGCAGTGACCAGAGG No data
1076637604_1076637610 4 Left 1076637604 10:131892390-131892412 CCACGCACGACGATCCCGGGAGG No data
Right 1076637610 10:131892417-131892439 GACCAGAGGGTTCAGTTTCCAGG No data
1076637604_1076637612 17 Left 1076637604 10:131892390-131892412 CCACGCACGACGATCCCGGGAGG No data
Right 1076637612 10:131892430-131892452 AGTTTCCAGGTCACTGCATGAGG No data
1076637604_1076637613 18 Left 1076637604 10:131892390-131892412 CCACGCACGACGATCCCGGGAGG No data
Right 1076637613 10:131892431-131892453 GTTTCCAGGTCACTGCATGAGGG No data
1076637604_1076637608 -9 Left 1076637604 10:131892390-131892412 CCACGCACGACGATCCCGGGAGG No data
Right 1076637608 10:131892404-131892426 CCCGGGAGGCAGTGACCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076637604 Original CRISPR CCTCCCGGGATCGTCGTGCG TGG (reversed) Intergenic