ID: 1076639588

View in Genome Browser
Species Human (GRCh38)
Location 10:131905117-131905139
Sequence TAAGTGTCCTGCTGATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076639586_1076639588 17 Left 1076639586 10:131905077-131905099 CCTGCAGGTAGGAGTAGAGCTGA 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1076639588 10:131905117-131905139 TAAGTGTCCTGCTGATGAGCAGG No data
1076639583_1076639588 20 Left 1076639583 10:131905074-131905096 CCCCCTGCAGGTAGGAGTAGAGC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1076639588 10:131905117-131905139 TAAGTGTCCTGCTGATGAGCAGG No data
1076639581_1076639588 25 Left 1076639581 10:131905069-131905091 CCCATCCCCCTGCAGGTAGGAGT 0: 1
1: 0
2: 1
3: 17
4: 142
Right 1076639588 10:131905117-131905139 TAAGTGTCCTGCTGATGAGCAGG No data
1076639582_1076639588 24 Left 1076639582 10:131905070-131905092 CCATCCCCCTGCAGGTAGGAGTA 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1076639588 10:131905117-131905139 TAAGTGTCCTGCTGATGAGCAGG No data
1076639584_1076639588 19 Left 1076639584 10:131905075-131905097 CCCCTGCAGGTAGGAGTAGAGCT 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1076639588 10:131905117-131905139 TAAGTGTCCTGCTGATGAGCAGG No data
1076639585_1076639588 18 Left 1076639585 10:131905076-131905098 CCCTGCAGGTAGGAGTAGAGCTG 0: 1
1: 0
2: 1
3: 20
4: 223
Right 1076639588 10:131905117-131905139 TAAGTGTCCTGCTGATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076639588 Original CRISPR TAAGTGTCCTGCTGATGAGC AGG Intronic
No off target data available for this crispr