ID: 1076640024

View in Genome Browser
Species Human (GRCh38)
Location 10:131909087-131909109
Sequence GGGTATAAGAAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076640012_1076640024 19 Left 1076640012 10:131909045-131909067 CCAGTACACAGACTTGGGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG No data
1076640010_1076640024 20 Left 1076640010 10:131909044-131909066 CCCAGTACACAGACTTGGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076640024 Original CRISPR GGGTATAAGAAGAGGGAGGA AGG Intronic
No off target data available for this crispr