ID: 1076640141

View in Genome Browser
Species Human (GRCh38)
Location 10:131910112-131910134
Sequence CGCTGCCACCTGGCGAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076640141_1076640143 -7 Left 1076640141 10:131910112-131910134 CCATAACTCGCCAGGTGGCAGCG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1076640143 10:131910128-131910150 GGCAGCGTGTTTGAGTGTGCCGG No data
1076640141_1076640144 1 Left 1076640141 10:131910112-131910134 CCATAACTCGCCAGGTGGCAGCG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1076640144 10:131910136-131910158 GTTTGAGTGTGCCGGCCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076640141 Original CRISPR CGCTGCCACCTGGCGAGTTA TGG (reversed) Intronic
901452932 1:9346807-9346829 AGCTGCCACCTGGCTGGGTATGG + Intronic
902368485 1:15991825-15991847 AGCTGCCACCGGGCCAGTCAGGG - Intergenic
906805447 1:48775965-48775987 CTCTGCCACCTGGCCAGGGAGGG + Intronic
916666128 1:166969197-166969219 CGCTGCCTCCTGGTGAGGCAAGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921849333 1:219918126-219918148 CTCTACCACCTGGTGATTTAAGG + Intronic
922890088 1:229055209-229055231 CTCTCCCACCTGGAGAGTTTTGG - Intergenic
1063142014 10:3263996-3264018 CGCTGGCAGGTGGGGAGTTAGGG - Intergenic
1076640141 10:131910112-131910134 CGCTGCCACCTGGCGAGTTATGG - Intronic
1083344884 11:61982400-61982422 CTCTCCCACCTGGAGAGTTTTGG - Intergenic
1083551573 11:63593972-63593994 CACTGCCACCAGGCGAGGGAGGG + Intronic
1089979720 11:122762325-122762347 CTCTGCCAACTGGGGAGTAAAGG + Intronic
1090012411 11:123056989-123057011 AGCTGCCACCTGGTTAATTAAGG - Intergenic
1090012788 11:123060505-123060527 CACTGGCACCTGGCGAGGGAGGG - Intronic
1090012925 11:123061611-123061633 CACTGGCACCTGGCGAGGGAGGG - Intronic
1096670900 12:53197739-53197761 CGCTGCGGCCTGGTGAGTTAGGG - Exonic
1122249820 14:100429956-100429978 TGCAGCCACCTGGGGAGTTAGGG + Intronic
1123552749 15:21398525-21398547 GGCTGCCACCTGGAGACTGATGG - Intergenic
1123588995 15:21835913-21835935 GGCTGCCACCTGGAGACTGATGG - Intergenic
1202961099 15_KI270727v1_random:125745-125767 GGCTGCCACCTGGAGACTGATGG - Intergenic
1133175281 16:4009929-4009951 CCCTGCCACCTGGTGACTTGTGG - Intronic
1137550207 16:49432392-49432414 TGCTGCCACCGGGCGAGATGGGG - Intergenic
1137717994 16:50610775-50610797 CGCTCCCAGCTGGCCAGTTAAGG - Intronic
1144728207 17:17512272-17512294 GGCTGCCTCCTGGGGAGTGAAGG - Intronic
1147312545 17:39604105-39604127 GGGTGCCACCTGGCGATTTCCGG - Intronic
1154453662 18:14501922-14501944 GGCTGCCACCTGGAGACTGATGG - Intergenic
1156544081 18:37946411-37946433 GGCTGCTACCTGGTGAGTCAGGG + Intergenic
1161838849 19:6666316-6666338 CGCTTGCACCTGGCAAGTTGAGG + Intronic
927869696 2:26615696-26615718 CGCTGCCACCTGGCGGTCTTGGG - Intronic
937908864 2:127065671-127065693 CGTTGCCATCTGGGGAGTTGTGG - Intronic
938115635 2:128601517-128601539 CGCTGCCACCGGGTGAGTAGGGG + Intergenic
938938228 2:136146345-136146367 TGCTGCCACCTGGCCTCTTATGG - Intergenic
939869074 2:147507132-147507154 AGCTGCCTACTGGCGAGGTAGGG + Intergenic
941008339 2:160270214-160270236 CGCAGCCACCGAGCGAGTCACGG + Intronic
946631382 2:221672718-221672740 GACTGCCACCTGGCCAGTGAGGG - Intergenic
1176820520 21:13651383-13651405 GGCTGCCACCTGGAGACTGATGG + Intergenic
1184539080 22:45107813-45107835 GGCTGCAACCTGGTGAGTGAGGG - Intergenic
1184859886 22:47167440-47167462 CCCTCCCACTTGCCGAGTTATGG - Intronic
956607979 3:71092285-71092307 CGCTTGAACCTGGTGAGTTAGGG + Intronic
960867307 3:122214775-122214797 TGCTGCCACGTGTCCAGTTAGGG - Intronic
966633454 3:182105347-182105369 CCCTCCCACCTGTCAAGTTATGG + Intergenic
972599079 4:40555862-40555884 CGATGACACCAGGTGAGTTAGGG + Intronic
972780252 4:42280884-42280906 AGCCACCACCTGGCGAGTTAGGG + Intergenic
978763397 4:112379545-112379567 CGCAGCCACCTGCCGAGGGAAGG - Intronic
979059733 4:116042845-116042867 AGCTTCCACCTGGCTTGTTAGGG - Intergenic
988077162 5:26367538-26367560 CTCTGCCTCCTTCCGAGTTAGGG - Intergenic
1003147170 6:3518281-3518303 CCCTGCCACCCTGCGAGTTATGG - Intergenic
1004190992 6:13463284-13463306 CACTGCCAATTAGCGAGTTAGGG + Intronic
1014173520 6:118306164-118306186 GGCTGCCACCTGGCCATTTTGGG - Intronic
1018638418 6:165885031-165885053 CGCTGCCACCTGGCGGTAAACGG - Intronic
1030740410 7:113102627-113102649 CTCTCCCACCTGGAGAGTTCTGG + Intergenic
1034986850 7:155521544-155521566 GGCTGCCGCCTGGCGATTTCAGG - Intronic
1036810689 8:11866381-11866403 CGTTGCCACCTGGGGAGCAAGGG + Intronic
1038405378 8:27318537-27318559 TGCAGCAACCTGGGGAGTTATGG + Intronic
1047402168 8:124556642-124556664 TGCTGCCACCTGGTGGGTGAGGG - Intronic
1062567141 9:137168367-137168389 CGCTGCCAGCTGGGAAGTCAGGG - Exonic
1203526730 Un_GL000213v1:97538-97560 GGCTGCCACCTGGAGACTGATGG - Intergenic
1190221326 X:48514226-48514248 CGCAGCCACCTGGGGAGAAAGGG - Exonic