ID: 1076643942

View in Genome Browser
Species Human (GRCh38)
Location 10:131938516-131938538
Sequence TAGCAGGCTGAAATGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076643942 Original CRISPR TAGCAGGCTGAAATGGGGAG GGG (reversed) Intronic
900925931 1:5705950-5705972 TGGCAGCCTGCAGTGGGGAGTGG - Intergenic
901367132 1:8762202-8762224 TAGGAGGCTGAAATTGGTAAGGG - Intronic
902271826 1:15310312-15310334 TAGAAGCCTGGAGTGGGGAGGGG - Intronic
902942947 1:19813729-19813751 TAGCTGGCAGAGATGGGGAGGGG - Intergenic
903375295 1:22862049-22862071 CAGCAGGCTGAAGCTGGGAGAGG + Intronic
903565473 1:24262093-24262115 TAGAAGTCTGAAATGGGGCTGGG + Intergenic
904014038 1:27406774-27406796 AAGCAGGCTGAAAGGCAGAGGGG - Exonic
904036721 1:27562842-27562864 TCGCAGGCTGTTGTGGGGAGTGG - Intronic
904753460 1:32755043-32755065 TTCCAGGCTCCAATGGGGAGGGG + Intronic
904853368 1:33476261-33476283 TAGCAGGCTATTGTGGGGAGAGG - Intronic
905876704 1:41436088-41436110 TAGCAGGCTAAGATTGGGATGGG + Intergenic
905925454 1:41746430-41746452 TGGGAAGTTGAAATGGGGAGGGG - Intronic
906111320 1:43323909-43323931 TGGCTGGCTGAAGTTGGGAGTGG - Intergenic
906720882 1:48003600-48003622 TAGCAGGCTGAAGTCGGGACTGG + Intergenic
908477925 1:64507201-64507223 TAGCTGGGAGAAATGAGGAGAGG - Intronic
908883320 1:68758537-68758559 CAGCCAGCAGAAATGGGGAGGGG + Intergenic
910383606 1:86657848-86657870 TAGCAGCCTGGCAGGGGGAGGGG + Intergenic
910391401 1:86748778-86748800 AAGCAGGCTCAAAGTGGGAGAGG - Intergenic
913128676 1:115816935-115816957 AAGCAGGTGGAAGTGGGGAGAGG + Intergenic
913335882 1:117708743-117708765 CAGGAGGCAGAAGTGGGGAGGGG - Intergenic
913380117 1:118201450-118201472 TCCCAGGCTGAAACAGGGAGAGG - Intergenic
913433899 1:118827106-118827128 TAGCAGGGAGAAGTGGGAAGTGG - Intergenic
914395362 1:147261829-147261851 TATTGGGCTGAGATGGGGAGGGG + Intronic
916780160 1:168018173-168018195 TAGTGGGCTCAAATGGGAAGGGG + Intronic
917471182 1:175327265-175327287 TATGAGGCAGAAATGGGAAGGGG - Intronic
918076994 1:181178027-181178049 GAGGAGGGAGAAATGGGGAGTGG + Intergenic
919320750 1:196034143-196034165 CAGCAGGCAGAAATGGGAATTGG - Intergenic
921217856 1:212951942-212951964 TGGCAGGAAGGAATGGGGAGAGG - Intronic
922233728 1:223707676-223707698 TAGAAGGCTGGCAAGGGGAGTGG + Intronic
923619968 1:235570638-235570660 TGGGAGGCTGAGAGGGGGAGTGG - Intronic
923720581 1:236463728-236463750 TAGGAAGCAGAAATGGGGAATGG - Intronic
924664432 1:246056261-246056283 TTGCAGGATGAAATGAGGAAAGG - Intronic
1062866394 10:859044-859066 TGGGAGGCTGAGATGGGCAGAGG + Intronic
1064300430 10:14118304-14118326 TAGCACACTGAAAAGGTGAGAGG + Intronic
1064676135 10:17762216-17762238 TAGCAGACTGAGATGTGGCGTGG - Intronic
1067278515 10:44854358-44854380 TAGCAGGCAGGGGTGGGGAGGGG + Intergenic
1068684429 10:59855190-59855212 TAGCTAGATGAATTGGGGAGGGG - Intronic
1069676878 10:70254964-70254986 TCCCAGGCTGGAATGGTGAGGGG + Exonic
1070728229 10:78807057-78807079 GTGCAGGCAGACATGGGGAGAGG - Intergenic
1071574422 10:86715303-86715325 GAGCAGACTGAAATGTGGTGAGG + Intronic
1071977366 10:90968446-90968468 TAGCAGTCTAAGATAGGGAGTGG - Intergenic
1073281681 10:102359234-102359256 TAGCAGGGAGATATGGGAAGAGG - Intronic
1074447942 10:113535710-113535732 GAACAGGCAGGAATGGGGAGTGG + Intergenic
1074911740 10:117916316-117916338 CAGGAGGGAGAAATGGGGAGAGG + Intergenic
1075416134 10:122265738-122265760 TAGGAGGCAGAAAGGGTGAGGGG + Intergenic
1075856040 10:125630997-125631019 AAGCAGGCAGAAGTGGGGATGGG - Intronic
1075908874 10:126106267-126106289 GAGGAGGCTGAGATGGGCAGAGG - Intronic
1076643942 10:131938516-131938538 TAGCAGGCTGAAATGGGGAGGGG - Intronic
1079090548 11:17477096-17477118 AGGCAGGCTAAGATGGGGAGTGG + Intergenic
1080807639 11:35669406-35669428 TAGCAGGGTGAAAAGGTGAGAGG + Intronic
1081303226 11:41478882-41478904 TAGAGGGCTGAAATCTGGAGAGG + Intergenic
1081622606 11:44627871-44627893 TAGGGGGCTGGAATGTGGAGAGG + Intergenic
1081694123 11:45097842-45097864 TGGCAGGAGGAAGTGGGGAGTGG + Intronic
1081869567 11:46377178-46377200 GAGCAGGGTGAGGTGGGGAGAGG - Exonic
1081931965 11:46877706-46877728 TAGGAGGCTGAGGTGGGCAGAGG - Intronic
1083448140 11:62724374-62724396 CAGCAGGCTCAGATGGTGAGCGG - Exonic
1084601902 11:70150638-70150660 TGGGAGGCTGAAATGGGAGGAGG - Intronic
1085526453 11:77166899-77166921 GTGCAGGGTGAGATGGGGAGAGG - Intronic
1085555867 11:77421142-77421164 TAGCAGGGTGAGATGAGGGGAGG - Intronic
1087698730 11:101412058-101412080 TACTAGGCAGAAAAGGGGAGGGG + Intergenic
1088417426 11:109605187-109605209 TGGCAGGCTGATGAGGGGAGAGG - Intergenic
1089496062 11:118909245-118909267 AAGCAGGAGGAAAGGGGGAGGGG + Intronic
1099906799 12:88780596-88780618 TAGCAGGAGGAAATGGGCAGAGG - Intergenic
1103851649 12:123937306-123937328 TAGCCAGCAGAAATGGGGTGGGG + Exonic
1104090870 12:125516686-125516708 TAGCAGGATGAAATGGCTGGTGG + Intronic
1104187688 12:126448469-126448491 TAGAAGCCTGAGATGGTGAGTGG + Intergenic
1104396654 12:128439733-128439755 TAGCTGACTGTAGTGGGGAGGGG + Intronic
1105903765 13:24782592-24782614 TGGGAGGCTGAGATGGGGGGGGG + Intronic
1106095020 13:26636225-26636247 AAGCAGCCTGACAGGGGGAGGGG - Intronic
1107325880 13:39241863-39241885 TAGGAGACTGAAACTGGGAGTGG + Intergenic
1107787542 13:43970731-43970753 GAGCAGGGTGAGGTGGGGAGAGG - Intergenic
1108028156 13:46200262-46200284 AAGCTGGCTGAAAGGGGAAGTGG + Intronic
1108499748 13:51059216-51059238 GATCAGACTGAAATGAGGAGTGG + Intergenic
1109311487 13:60699669-60699691 CAGAAGCCTGCAATGGGGAGTGG + Intergenic
1109808634 13:67477723-67477745 TAGCAGGCTGGATTTAGGAGAGG + Intergenic
1110601078 13:77374878-77374900 GAGCAGGCTAAGAAGGGGAGAGG - Intergenic
1111382029 13:87468468-87468490 TAGGAGGCTGGAGAGGGGAGGGG + Intergenic
1112740696 13:102469684-102469706 TAGCTTGCTCAAATGGGGAAAGG - Intergenic
1113581250 13:111431070-111431092 CACCAGGCTGAAAAGGGGAGGGG - Intergenic
1114573229 14:23690265-23690287 CAGCAGCCTGGAAGGGGGAGGGG - Intergenic
1115546471 14:34468899-34468921 AAGCAGGCATGAATGGGGAGAGG - Intergenic
1115909335 14:38238346-38238368 TAGGAGGCTGAAGTGGGGGTGGG - Intergenic
1115917180 14:38328871-38328893 TTCCAGGCTGAAAAGGGTAGTGG + Intergenic
1115946251 14:38664871-38664893 GCGCAGGATGAAATGGGGAGCGG - Intergenic
1120682359 14:87495588-87495610 CAGGAGGCTGAGATGGTGAGAGG - Intergenic
1123579507 15:21703635-21703657 GAGCAGGCTCAGATGGGAAGTGG + Intergenic
1123616134 15:22146146-22146168 GAGCAGGCTCAGATGGGAAGTGG + Intergenic
1123821089 15:24031180-24031202 TAGCAGGCTGAGTAGGGGAAAGG + Intergenic
1123910221 15:24958452-24958474 TAGCATCCAGAAATGGAGAGAGG - Intronic
1126648351 15:50897210-50897232 TGGCTGGCTGAAAAGAGGAGAGG + Intergenic
1127131209 15:55865795-55865817 TAGCAGGGAGAAATGGATAGGGG + Intronic
1127382917 15:58445085-58445107 TAGCAGGGTGGGATGGGGAGTGG + Intronic
1127676284 15:61242472-61242494 TGTCAGTCTGAAATGGGGAGGGG - Intergenic
1127723371 15:61724669-61724691 CAGCAGGCTGACATGGGAGGTGG + Intergenic
1128516242 15:68343855-68343877 CAGGAGGCTTAAATGGGGTGTGG + Intronic
1128690277 15:69719372-69719394 TGCCAGTCTCAAATGGGGAGGGG + Intergenic
1130196781 15:81786954-81786976 CAGCTGTCTGGAATGGGGAGAGG - Intergenic
1130862113 15:87900344-87900366 TAGCATCCTGGAATGGGGACAGG + Intronic
1131511716 15:93052720-93052742 CAGCAGGCTGAAAGGGCTAGTGG + Intronic
1131661884 15:94526093-94526115 GAGAGGGCTGAGATGGGGAGAGG - Intergenic
1202988377 15_KI270727v1_random:437880-437902 GAGCAGGCTCAGATGGGAAGTGG + Intergenic
1133360627 16:5171008-5171030 TAAGAGGCTCCAATGGGGAGAGG - Intergenic
1134027078 16:10962632-10962654 TAGCAGGGTGAAGTTGGGCGTGG + Intronic
1136110020 16:28058967-28058989 GTGCAGGATGAACTGGGGAGTGG + Intronic
1138111938 16:54330786-54330808 TACCCTGCTGAGATGGGGAGAGG + Intergenic
1139925348 16:70482953-70482975 GAGAAGGAAGAAATGGGGAGAGG - Intronic
1140047964 16:71454983-71455005 GAGCAGGCTGAGGTGGGCAGAGG - Intronic
1140854815 16:78968655-78968677 AAGGAGGCTGATATCGGGAGAGG + Intronic
1140860449 16:79013310-79013332 CAGCAGGCTGTGCTGGGGAGTGG + Intronic
1142813945 17:2410924-2410946 TATCGGGCTGGACTGGGGAGAGG + Intronic
1142878981 17:2869844-2869866 TAGGAGGCTGATCTGGTGAGCGG + Intronic
1143281553 17:5758343-5758365 AAGCAGGTTGACATGGAGAGAGG - Intergenic
1143428751 17:6863069-6863091 GAGGAGGCTGCAGTGGGGAGAGG + Intergenic
1144674344 17:17152422-17152444 TACCAGGGTGAAGTGAGGAGGGG - Intronic
1144783568 17:17819764-17819786 GAGCAGGTTGAAAGTGGGAGAGG - Intronic
1144811751 17:18004833-18004855 CTGCAGGCTGCAATGCGGAGGGG - Intronic
1145017984 17:19411387-19411409 TGGGAGGCTGGGATGGGGAGAGG - Exonic
1145209290 17:21001358-21001380 TAGCTGGCTGGGCTGGGGAGGGG - Exonic
1146656225 17:34636748-34636770 CAACAGGCAGAAGTGGGGAGGGG + Intronic
1146929537 17:36767807-36767829 TTTCAGGCTGAGGTGGGGAGGGG + Intergenic
1147337496 17:39736395-39736417 AAGCTGGCTGACATGGGAAGGGG - Intergenic
1147858521 17:43501726-43501748 TGGGAGGCTGAGATGGGGGGGGG - Intronic
1147869527 17:43577777-43577799 TGGGAAGCTGCAATGGGGAGGGG - Intronic
1147872411 17:43596934-43596956 TAGCAGACAGGAATGAGGAGTGG - Intergenic
1148027289 17:44597332-44597354 TAGAAGGATGAACTGGGAAGGGG + Intergenic
1148568438 17:48647367-48647389 AAGGAGGCTGAGAAGGGGAGGGG + Intergenic
1148866139 17:50629705-50629727 AAGGAGGCTGGGATGGGGAGTGG + Intergenic
1149702518 17:58667218-58667240 TAGCAGGCTGTACTGCAGAGTGG + Intronic
1151670498 17:75569327-75569349 TAGCAGGCTGGGCTGGGGAGGGG + Intronic
1151898499 17:76996612-76996634 GAGCAGGCTGAGCTGGGGAAGGG - Intergenic
1152233365 17:79125831-79125853 TTCCAGGCAGAAATGGGGAAGGG + Intronic
1152374090 17:79909330-79909352 TGGGAGGCTGAGATGGGGGGGGG - Intergenic
1153240799 18:3029858-3029880 TAGGAGGCTAAAAAGGGAAGAGG - Intergenic
1155677123 18:28442415-28442437 TGGGAGGGTGAAGTGGGGAGGGG + Intergenic
1158625399 18:59067077-59067099 TATCAGGGAGAAATGGGGAAGGG - Intergenic
1158719422 18:59910790-59910812 TGGGAGGCCGAAATGGGCAGAGG - Intergenic
1159478834 18:68960406-68960428 TTGAAGACTGAAAAGGGGAGAGG - Intronic
1160750124 19:730040-730062 AAGCAGGCTGCCCTGGGGAGGGG - Intronic
1161661291 19:5548190-5548212 TAGCAGGATAAAATGGTGTGAGG - Intergenic
1162046210 19:8002106-8002128 AAGAAGGCTGAGATGGGTAGTGG - Intronic
1162062556 19:8105652-8105674 TAGCAGGCAAAAATAGGTAGTGG + Intronic
1163659290 19:18567271-18567293 GACCAGGCTGTAATGGGCAGTGG + Intronic
1163811180 19:19432773-19432795 GAGCAGGCTGAAGTGGGGATGGG + Intronic
1164430522 19:28184581-28184603 TAGCAGGGTGTGGTGGGGAGTGG - Intergenic
1165077292 19:33286913-33286935 TATCAGGCTGAAGGGGCGAGGGG + Intergenic
1165386075 19:35511370-35511392 TGGAAGGCTGAGATGGGGTGAGG - Intronic
1166014862 19:39972046-39972068 CATCAGGGTGAAGTGGGGAGGGG + Intronic
1166292185 19:41870329-41870351 TCGCAGGCTGACCTGGGGAGGGG - Intronic
1166856906 19:45786725-45786747 CAGCAGGCTGTACTGGGGCGGGG + Exonic
1167055874 19:47111692-47111714 TAGAAGGCCGAATTGGGGAGGGG - Intronic
1168037117 19:53728805-53728827 TAGGAGGCTGAAGTGGGAGGTGG - Intergenic
925091625 2:1161117-1161139 CTGCAGGTGGAAATGGGGAGAGG + Intronic
925985701 2:9213196-9213218 GAGCAGGCTGGAATGCAGAGAGG + Intronic
928950169 2:36807114-36807136 TACCAGCTTGAACTGGGGAGGGG - Intronic
929455818 2:42064284-42064306 CAGCAGGCTGGACTGGGGGGTGG + Intergenic
930094056 2:47553026-47553048 TGGCAGGATGAATTGGGTAGAGG - Intronic
932525213 2:72458853-72458875 CAGCATGATGAAATGGGGACAGG + Intronic
934537365 2:95146491-95146513 TTGCAGGCTGAGATGTGGAAAGG + Intronic
936045446 2:109184364-109184386 TAGCAGGATGAAATGCAGAAAGG + Intronic
936374098 2:111926265-111926287 TAGAAGGCAAAAATGGGAAGTGG - Intronic
937004699 2:118500937-118500959 CATCAGACTCAAATGGGGAGAGG + Intergenic
937009830 2:118552461-118552483 CAGTAGGCTGGAATGGGGAAGGG - Intergenic
937481686 2:122268197-122268219 GAGGAGGGGGAAATGGGGAGCGG - Intergenic
937682317 2:124657279-124657301 TATTTGGCAGAAATGGGGAGAGG - Intronic
938958914 2:136323399-136323421 CAGCAGGCTGGAAAGGGGTGGGG - Intergenic
939082166 2:137675169-137675191 GAGCAGGGTGAAATGGGGGAGGG + Intronic
939164004 2:138620737-138620759 TTGCAGGCTGTGATGGGAAGGGG + Intergenic
939395122 2:141619139-141619161 AAGCAGGTTGAGGTGGGGAGTGG - Intronic
939763937 2:146221851-146221873 TATCAGACTGAAATTGTGAGAGG - Intergenic
942835503 2:180291943-180291965 GAGCAGGGTGAAGTGGGGAAAGG + Intergenic
943226462 2:185185186-185185208 CAGCAGGCTGAGGTGGCGAGGGG - Intergenic
944165072 2:196710226-196710248 CAGCAGCCTGGCATGGGGAGGGG - Intronic
946776104 2:223142851-223142873 GAGCAGGGTGAGATGGGGAGTGG - Intronic
947505802 2:230707749-230707771 TAACAAGCTGAGATGGGAAGGGG - Intergenic
948598620 2:239096032-239096054 GAGCAGGCTGAGAATGGGAGAGG - Intronic
948805397 2:240451731-240451753 GAGCAGGCTGGCATGGGGGGAGG + Intronic
1168803168 20:656778-656800 TAGCATCCTCAAAAGGGGAGGGG - Intronic
1169927843 20:10801776-10801798 TAGCAGGATGAAGTGGGGGCGGG - Intergenic
1170725283 20:18920651-18920673 GAGCAGGAGGAAGTGGGGAGAGG - Intergenic
1171244524 20:23600869-23600891 TTGCACGCTGAATTGGGGAAGGG - Intergenic
1172135072 20:32681313-32681335 CAGCAGGCTGGAGAGGGGAGAGG + Intergenic
1173667824 20:44775308-44775330 TAGCATGCTACAGTGGGGAGGGG - Intronic
1174899515 20:54484051-54484073 TAGCAGGTGGAAAGTGGGAGAGG - Intronic
1175590161 20:60183306-60183328 GAGAAGGCTGTAATTGGGAGGGG - Intergenic
1177393709 21:20507659-20507681 GTGCTGGCTGAGATGGGGAGGGG + Intergenic
1183309038 22:37099314-37099336 GAGCAGTCAGAGATGGGGAGGGG + Intronic
1183736252 22:39646460-39646482 CAGCAGGGAGACATGGGGAGAGG - Intronic
1184122240 22:42459600-42459622 TAGCAGGATGGTCTGGGGAGAGG - Intergenic
1184671418 22:46013936-46013958 GAGCAGGCGGGAATGTGGAGGGG - Intergenic
949597280 3:5561484-5561506 TAGCAGGCTGAATCTGGGTGGGG + Intergenic
949919248 3:8988347-8988369 TTGCAGGCTGCAAAGGGGAGTGG - Intronic
950211577 3:11127167-11127189 AAGGATGCTGAGATGGGGAGGGG + Intergenic
950406595 3:12808895-12808917 GGGCAGGCTGTAATGTGGAGAGG + Intronic
952924960 3:38313995-38314017 TGGCAGGCGGCACTGGGGAGGGG - Intronic
953169013 3:40490591-40490613 AAGCAGGCTGAGAAGGGGAGAGG - Intergenic
956833021 3:73072176-73072198 TAGCATGGTGTAATGGGCAGAGG + Intergenic
957144415 3:76405010-76405032 TGACAGGATGAAATGGGGAAGGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958037000 3:88182350-88182372 CTGCAGGCTGGAGTGGGGAGGGG + Intergenic
958178870 3:90031633-90031655 TGGTGGGCTGAAATGGGCAGTGG - Intergenic
959198647 3:103218196-103218218 TAGCAGCTTTAAATGGGGGGGGG + Intergenic
960348519 3:116564983-116565005 AAACAGGCTGAAATGGGCAACGG - Intronic
960964226 3:123093547-123093569 TAGGTGGCAGAAATGGGCAGAGG + Intronic
961135579 3:124507198-124507220 TGGCAGGATGAAGTGGGGTGGGG - Intronic
962462852 3:135630681-135630703 TAGCAGGATGAACTGTGCAGAGG + Intergenic
962953247 3:140240924-140240946 TAAGAGGCTGAGGTGGGGAGTGG + Intronic
963031369 3:140981472-140981494 TTACAGGCTGACATGGGGAGGGG + Intergenic
963091989 3:141490904-141490926 GAGCAGGCAGAGATGAGGAGGGG - Intronic
963574981 3:147048753-147048775 TAGCAGGCTGAAAGGTAGAAGGG - Intergenic
964383800 3:156126069-156126091 GAGCAGGAGGAGATGGGGAGGGG + Intronic
965849934 3:173010854-173010876 GTGCTGGCTGTAATGGGGAGGGG - Intronic
967420639 3:189268429-189268451 TATCTGGAAGAAATGGGGAGTGG - Intronic
967612724 3:191526885-191526907 TAGCAGGCAAAAATGGAGAGGGG - Intergenic
968003015 3:195220591-195220613 GAGCAGGCTGAAAGGGGGATTGG - Intronic
971190074 4:24419526-24419548 TCCAAGGCTGAAATTGGGAGAGG - Intergenic
972279993 4:37592502-37592524 TAGAAGGCTGAAATCCAGAGAGG - Intronic
972461870 4:39311765-39311787 TAGCAGGTTGGCATGGGAAGTGG + Intronic
975759420 4:77604321-77604343 AAGGAGGCTGAATTGGGCAGGGG - Intronic
976140600 4:81987543-81987565 TAGGAGGCTGAAGTGGCCAGAGG - Intronic
977984596 4:103367205-103367227 TAGAATGTGGAAATGGGGAGTGG + Intergenic
978399377 4:108314565-108314587 TAGCAGCCAGATTTGGGGAGTGG - Intergenic
978618214 4:110615896-110615918 TACCAGGCTGAGAGGCGGAGAGG + Intergenic
980743893 4:136990216-136990238 TAGCAGCCTTAACTGGAGAGGGG - Intergenic
981509970 4:145545119-145545141 TAGCAGGCTGAATTGGCCTGTGG - Intronic
981827693 4:148962658-148962680 AAGAAGGCTGTTATGGGGAGTGG - Intergenic
982170367 4:152655876-152655898 TAGCTGGCTGTAATAGGTAGGGG - Intronic
982392097 4:154876152-154876174 AAGCAGGCTGAAAAGGAAAGAGG - Intergenic
983112756 4:163773212-163773234 TACCTGACAGAAATGGGGAGAGG + Intronic
984609470 4:181821212-181821234 TAGCAGACTGAGATGCGGTGAGG - Intergenic
986858327 5:11898198-11898220 CAACATGCTGAGATGGGGAGTGG + Intronic
987096025 5:14550954-14550976 CATCAAGCTGAAATGGGGTGTGG + Intergenic
989648433 5:43662043-43662065 TGGCATGCTGATATGGGGAGAGG + Intronic
991092341 5:62705370-62705392 TAGAAGGCTGAGATGAGGATAGG + Intergenic
991893533 5:71365677-71365699 TAGGAGGAGGAAATGAGGAGGGG + Intergenic
992097033 5:73372432-73372454 TGGCTGGTTGAGATGGGGAGAGG - Intergenic
993440276 5:87948538-87948560 CAGCAGGCAGAACTGTGGAGAGG + Intergenic
993819306 5:92594284-92594306 TAGCAGGCTGACATTAGGACTGG + Intergenic
994545652 5:101163258-101163280 CAGCAGCCTGACAGGGGGAGGGG + Intergenic
995163330 5:109008321-109008343 TAGCTGTGGGAAATGGGGAGAGG - Intronic
995203786 5:109456218-109456240 TAGGAGGCTGAGATAGGGGGAGG + Intergenic
995491346 5:112694994-112695016 CAGCAGCTGGAAATGGGGAGGGG + Intergenic
995595520 5:113743749-113743771 TCCCCGGCTGGAATGGGGAGAGG + Intergenic
995655397 5:114420802-114420824 TAGCATGAAGAAGTGGGGAGAGG - Intronic
997691832 5:135832437-135832459 TGGCAGGTGGACATGGGGAGGGG + Intergenic
999231590 5:150065194-150065216 CAGCAGGCCTAGATGGGGAGGGG - Intronic
999658175 5:153830802-153830824 TACCAGGCTGAAGAGGGCAGTGG + Intergenic
1001275528 5:170348237-170348259 TTACAGGCTGAACAGGGGAGGGG - Intergenic
1003077955 6:2999485-2999507 TACCAGCCAGAGATGGGGAGCGG + Intronic
1003149982 6:3540329-3540351 CAGCCAGCAGAAATGGGGAGGGG - Intergenic
1005668863 6:28084410-28084432 TGGGAGGCTGAGATGGGCAGTGG + Intronic
1006313941 6:33279418-33279440 TGGCAGGCTGACAAGGGCAGAGG + Intronic
1006662642 6:35661005-35661027 AAACAGGAGGAAATGGGGAGTGG + Intronic
1007138991 6:39552770-39552792 TAACAGGCTGAAATGGTAGGGGG + Intronic
1007924372 6:45639777-45639799 CAGGAGGATGGAATGGGGAGGGG + Intronic
1007996710 6:46315552-46315574 GAGCAGAGTGAAAGGGGGAGAGG + Intronic
1011715305 6:90098869-90098891 TAGCCAGCTGAATTGGGGAGAGG - Intronic
1012568635 6:100694365-100694387 TGGGAGGCTGAGATGGGAAGTGG + Intronic
1013456618 6:110335313-110335335 TTCCAATCTGAAATGGGGAGAGG - Intronic
1013598850 6:111685431-111685453 TACCAGATTGAAAAGGGGAGCGG - Intronic
1014910892 6:127091705-127091727 GAGCAGCCTGAGATGGGAAGAGG + Intergenic
1015237489 6:130987756-130987778 TAGGAGGCTAAAATTGGGAAAGG + Intronic
1015419110 6:132986183-132986205 CAGCAGCCTGGCATGGGGAGGGG - Intergenic
1015756876 6:136616545-136616567 TGGGAGGCTGAGGTGGGGAGAGG - Intronic
1015907705 6:138134963-138134985 TAGAAGGCTGGAATGGGTACTGG + Intergenic
1016401858 6:143689627-143689649 TATGATTCTGAAATGGGGAGAGG - Intronic
1016913052 6:149217751-149217773 GTGCAGGCTAAAAAGGGGAGAGG - Intergenic
1021736050 7:23638892-23638914 TAGCAACCTAAAATGGGCAGGGG - Intronic
1023736761 7:43242320-43242342 GAGGAGGCAGAAATGGTGAGAGG + Intronic
1023777128 7:43618321-43618343 TGTCAGGCAGAAAAGGGGAGAGG + Intronic
1024298082 7:47862358-47862380 GAGCAGCCTGAGATGAGGAGGGG + Intronic
1025859044 7:65309423-65309445 CACCAGGCTGAAATGGGTGGCGG - Intergenic
1030551984 7:110973054-110973076 TTGGGGGCAGAAATGGGGAGTGG + Intronic
1031400877 7:121325353-121325375 TTGCAGGCTGAGAGGGGCAGTGG - Intronic
1031807379 7:126324777-126324799 TTGCAGGTTGAAATGTGGAAAGG - Intergenic
1031964671 7:128019088-128019110 TAGCTGGCTGAGGTGGGGAGGGG - Intronic
1032077164 7:128841419-128841441 AAGAAGGCTGAGTTGGGGAGGGG - Intronic
1032251574 7:130262198-130262220 CAGGAGGCAGATATGGGGAGGGG + Intergenic
1032500043 7:132393247-132393269 TAGGAGCCTAGAATGGGGAGTGG - Intronic
1032747902 7:134806334-134806356 TAGTAGGCTGTCATGGGTAGAGG + Intronic
1033134953 7:138776557-138776579 TAGGAGGGTGAAGTGGAGAGTGG - Intronic
1037715561 8:21394593-21394615 TAGCAGGCTGGAAGAGGGACAGG - Intergenic
1037838096 8:22226375-22226397 TAGCAGAGGGAAATGGGGGGCGG + Intronic
1038185043 8:25265326-25265348 CAAGAGACTGAAATGGGGAGAGG - Intronic
1041559104 8:59194441-59194463 TAGCAGGATGAAAGAGAGAGAGG - Intergenic
1042297047 8:67231692-67231714 ATGCAGGCTGAAAGGTGGAGAGG + Intronic
1043617345 8:82143335-82143357 TAGAAGGCTGAACTGGAGAATGG - Intergenic
1043990465 8:86746741-86746763 TTGCAGGCTGAAGTTGGGATAGG + Intergenic
1044576956 8:93780089-93780111 CAGCAGGCTGGCAGGGGGAGGGG - Intronic
1045342620 8:101268050-101268072 TGGCAGGGGGACATGGGGAGGGG - Intergenic
1046796773 8:118381909-118381931 CAGCAGCCAGAAATGGGGAAAGG - Intronic
1048117097 8:131535860-131535882 GAGAAGGAGGAAATGGGGAGTGG - Intergenic
1048985652 8:139733431-139733453 TAGCAGGCTAAGATGTGGGGTGG + Intronic
1049591998 8:143466836-143466858 GAGCAGGCTGGGAAGGGGAGGGG - Intronic
1049678534 8:143904592-143904614 CAGAGGGCTGATATGGGGAGGGG - Intergenic
1049839911 8:144764317-144764339 GAGCTGGCGGAAATGGGAAGCGG + Intergenic
1049849802 8:144824797-144824819 CAGGAGGCAGAAAGGGGGAGAGG - Intergenic
1051062315 9:13058830-13058852 GAAAAGGCTGAAATGGGGTGGGG - Intergenic
1057914465 9:99045096-99045118 TAGCAGGCTGAAGTTGGGGAGGG + Intronic
1058648879 9:107156422-107156444 GAGCAGGCCGAGATGGGCAGGGG - Intergenic
1058825855 9:108775262-108775284 TAGCTGGCTGAAATAAGGAGGGG + Intergenic
1059384116 9:113950758-113950780 TGGCAGGGTGAGATGGGAAGTGG + Intronic
1059801054 9:117749990-117750012 TGGAAGGCTGCACTGGGGAGGGG - Intergenic
1060948684 9:127586701-127586723 TGGCGGGGTGAAATGGGGACAGG + Intergenic
1062572689 9:137192896-137192918 TCCCTGGCTGGAATGGGGAGGGG - Intronic
1185986947 X:4845372-4845394 TAGCAGCCTGAAATGGACTGAGG + Intergenic
1186285772 X:8042512-8042534 TAGGAGGCTGCATTGAGGAGAGG + Intergenic
1186713536 X:12226307-12226329 TAGGAGGATAGAATGGGGAGGGG + Intronic
1186941295 X:14510469-14510491 GAGCAGGATGAAAGGTGGAGAGG + Intergenic
1187286235 X:17906473-17906495 CAGCATGCAGATATGGGGAGAGG - Intergenic
1188525664 X:31085305-31085327 TAGCACGCTCAAACAGGGAGGGG - Intergenic
1190136891 X:47806179-47806201 AAGCAGGCTGAAAGGCAGAGGGG + Intergenic
1191077369 X:56469291-56469313 CAGCCGGCTGAATTTGGGAGGGG - Intergenic
1192914901 X:75641522-75641544 GAACACACTGAAATGGGGAGGGG - Intergenic
1195544563 X:106100565-106100587 GAGAAGGCTGAAGTGGAGAGAGG + Intergenic
1196992160 X:121341941-121341963 GAAGAGGCTGAAATGGGAAGTGG + Intergenic
1197245452 X:124161902-124161924 TGGCAGCATGAATTGGGGAGGGG + Intronic
1198300716 X:135331947-135331969 CTGTAGGATGAAATGGGGAGGGG + Intronic
1198633952 X:138674555-138674577 AAGCAAGCTGAAAGAGGGAGTGG + Intronic
1199161114 X:144613295-144613317 AAGCATGCTGAAGTGGGGAATGG - Intergenic
1199897282 X:152137336-152137358 CGGCAGGCAGAAGTGGGGAGGGG + Intronic
1199953541 X:152724722-152724744 TAACATTCTGAAATGGGGACAGG + Intergenic
1199956141 X:152743728-152743750 TAACATTCTGAAATGGGGACAGG - Intergenic
1201010825 Y:9547287-9547309 CAGCAGGCTCAAATGCGGACAGG + Intergenic