ID: 1076644229

View in Genome Browser
Species Human (GRCh38)
Location 10:131941363-131941385
Sequence GTCTTAAATTAGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076644224_1076644229 22 Left 1076644224 10:131941318-131941340 CCTCAATGTCTTATAATTGGCCT 0: 1
1: 0
2: 2
3: 12
4: 266
Right 1076644229 10:131941363-131941385 GTCTTAAATTAGATGGAACATGG No data
1076644226_1076644229 2 Left 1076644226 10:131941338-131941360 CCTGGTGCTACGCACCACTGATG 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1076644229 10:131941363-131941385 GTCTTAAATTAGATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076644229 Original CRISPR GTCTTAAATTAGATGGAACA TGG Intronic
No off target data available for this crispr