ID: 1076644660

View in Genome Browser
Species Human (GRCh38)
Location 10:131944666-131944688
Sequence ACTGGACAGCAGAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 750
Summary {0: 1, 1: 0, 2: 9, 3: 91, 4: 649}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076644660_1076644669 9 Left 1076644660 10:131944666-131944688 CCGTCCTCCCTCTGCTGTCCAGT 0: 1
1: 0
2: 9
3: 91
4: 649
Right 1076644669 10:131944698-131944720 TGGGGTTCCATGTCGTATGTTGG No data
1076644660_1076644667 -9 Left 1076644660 10:131944666-131944688 CCGTCCTCCCTCTGCTGTCCAGT 0: 1
1: 0
2: 9
3: 91
4: 649
Right 1076644667 10:131944680-131944702 CTGTCCAGTGGCTTGAGCTGGGG No data
1076644660_1076644666 -10 Left 1076644660 10:131944666-131944688 CCGTCCTCCCTCTGCTGTCCAGT 0: 1
1: 0
2: 9
3: 91
4: 649
Right 1076644666 10:131944679-131944701 GCTGTCCAGTGGCTTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076644660 Original CRISPR ACTGGACAGCAGAGGGAGGA CGG (reversed) Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900422436 1:2561409-2561431 ACAGGACGGCAGAGGGAGAGGGG - Intronic
900423428 1:2565407-2565429 ACAGGACGGCAGAGGGAGAGGGG + Intergenic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
901758152 1:11453904-11453926 CCAGGACAGCAGAGAGGGGAAGG - Intergenic
901977697 1:13008436-13008458 ACTGGAGAGTGGAGGGTGGAAGG - Intronic
902004388 1:13220499-13220521 ACTGGAGAGTGGAGGGTGGAAGG + Intergenic
902023611 1:13366237-13366259 ACTGGAGAGTGGAGGGTGGAAGG + Intergenic
902110045 1:14070903-14070925 ATTGCACAGCAGAGAGTGGAAGG + Intergenic
902329427 1:15724050-15724072 ACAGGGCAGGAGAGGGAGCACGG - Intronic
902614982 1:17618780-17618802 GCTGGACCTCAGACGGAGGACGG - Intronic
902629703 1:17697299-17697321 TCTGGGCAGCAGTGGGAGGCAGG + Exonic
902778906 1:18692144-18692166 GCTGGACAGCCCAAGGAGGAGGG + Intronic
903070041 1:20722573-20722595 GCAGGACAGTAGAGGCAGGATGG + Intronic
903273645 1:22207662-22207684 ACTGGACAGGAGTGGAGGGAGGG - Intergenic
904001193 1:27339733-27339755 ACAGGAGAGCAGAGAAAGGAAGG + Intergenic
904044635 1:27602350-27602372 AGGGGCCAGCTGAGGGAGGAAGG - Intronic
904449279 1:30600653-30600675 CCTGGACAGAGTAGGGAGGAAGG - Intergenic
905304312 1:37007003-37007025 CTTGCACAGCAGAGGGAAGACGG - Intronic
905312925 1:37063084-37063106 ACTGGAGGTGAGAGGGAGGAAGG - Intergenic
905960424 1:42038023-42038045 ACTGGAGAGAAGATAGAGGATGG - Intergenic
906176347 1:43776708-43776730 AATGGAGGGCACAGGGAGGAAGG - Intronic
906202951 1:43971638-43971660 TCTGGACAGCAGGAGGAGAAGGG - Exonic
906641569 1:47444027-47444049 ACCGGAGCGGAGAGGGAGGAGGG - Intergenic
906703557 1:47877447-47877469 AAGGGACAGAAGAGGGAGGGAGG - Intronic
906801917 1:48745436-48745458 AACGGACATCAGAGGGAGCAGGG + Intronic
906935295 1:50209249-50209271 ACAGGAAAGCAGAGGGATGTGGG - Intergenic
907090790 1:51723515-51723537 ACAGGAAAGAAGAGGAAGGAAGG - Intronic
907567003 1:55444654-55444676 GCAGGAGATCAGAGGGAGGAGGG + Intergenic
908062700 1:60369143-60369165 ACTAGACAGGGGAGGGAGGGAGG - Intergenic
908736402 1:67281537-67281559 ACTGGACATATGAGGGAGGGAGG + Intergenic
908768125 1:67572400-67572422 ACAGGAGAGCAGAGGGAAGGAGG + Intergenic
909280812 1:73750568-73750590 ACTGGACATAAAAGGGAAGAAGG + Intergenic
909435164 1:75632534-75632556 AATGGTCAGCAGAGGGTGAAGGG - Intergenic
910153949 1:84191673-84191695 ACTAGAGAGGAGAGGGAGGGAGG + Intronic
910361608 1:86417984-86418006 ACAGGACAGCAGAGTGAGAGAGG - Intergenic
910736297 1:90461596-90461618 ACTTGAGGGCAGAGGGAGGGAGG - Intergenic
910763945 1:90762017-90762039 ATCAGACAGCCGAGGGAGGAGGG + Intergenic
910891826 1:92026851-92026873 GCTGGGCATCAGAGGGGGGACGG + Intergenic
910909791 1:92221326-92221348 ACTAGAGGGGAGAGGGAGGAAGG + Intronic
911093383 1:94035812-94035834 AGTTTACAGCAGAGGGTGGAGGG - Intronic
911380158 1:97104686-97104708 AATAAACAGCAGAGGGAGAAGGG + Intronic
912130134 1:106589770-106589792 AATGGACAGCAGAGGCAAAATGG - Intergenic
912188933 1:107315228-107315250 AATGGACAGAAGAGGATGGATGG - Intronic
912944848 1:114076392-114076414 ACTGCCTCGCAGAGGGAGGAAGG + Intergenic
914221505 1:145686247-145686269 ACTGGACAGCAGTGGGGGTGGGG - Intronic
914263967 1:146021778-146021800 ACTGGACAGCTGAGCAGGGAGGG + Intronic
914474068 1:148009116-148009138 ACTGGACAGCAGTGGGGGTGGGG - Intergenic
915249081 1:154575962-154575984 ACTGTGCAGCAGAGGGTGGCAGG - Exonic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915822675 1:159042102-159042124 GCTGGACACCAGAGGGAAAATGG - Intronic
915910187 1:159910196-159910218 TCTAGAGAGCAGAGGGAGGAAGG + Intergenic
915939035 1:160106746-160106768 ATTGGACATCAGAGTAAGGAAGG - Intergenic
916330928 1:163615911-163615933 ACTGTGCAGCAGATGCAGGATGG + Intergenic
916633581 1:166642979-166643001 ACTAGATAGAAGAGGGAGGAAGG + Intergenic
916720441 1:167481461-167481483 AGTTGGGAGCAGAGGGAGGATGG + Intronic
919408861 1:197218779-197218801 ACTGGAGAACAAAGAGAGGAGGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921345478 1:214179509-214179531 TCTGGACAGCAGTGCAAGGAGGG + Intergenic
921506224 1:215974007-215974029 ATTTGACAGCATATGGAGGAAGG + Intronic
921799527 1:219386092-219386114 ACTGGGCAACAGAGGGGAGACGG + Intergenic
922925017 1:229341491-229341513 TCTGGACAGGCGAGGGAGGATGG + Intronic
923934933 1:238749140-238749162 TCTGAACATCAAAGGGAGGAAGG + Intergenic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
924908737 1:248485796-248485818 TGTAGACTGCAGAGGGAGGATGG + Intergenic
924915371 1:248562266-248562288 TGTAGACTGCAGAGGGAGGATGG - Intergenic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1064745875 10:18477668-18477690 AGTGGGCTGCAGAGGGAAGATGG + Intronic
1065731543 10:28713829-28713851 GCTGGACAGCACAGGGAAAAGGG - Intergenic
1066990105 10:42505046-42505068 ACTGGACAACAGAGCAATGAAGG + Intergenic
1067522568 10:47019373-47019395 ACTGGCCAGGAGATAGAGGAAGG + Intergenic
1067918370 10:50425591-50425613 ACTAGACAGGGGAGGGAGGAAGG + Intronic
1069228481 10:65974586-65974608 ACTAGACAGGGGAGGGAGGAAGG + Intronic
1069589687 10:69634141-69634163 TCTGGGCCACAGAGGGAGGAGGG + Intergenic
1069709706 10:70480465-70480487 ACTGGCCAGGAAAGGGAGGGGGG - Intronic
1069791064 10:71021302-71021324 AATGGACAGCAGAGGAAAAACGG - Intergenic
1069807087 10:71132801-71132823 ACAGGGGAGAAGAGGGAGGATGG - Intergenic
1069963742 10:72096261-72096283 ACGGACCAGCAGAGGGAGGCGGG - Intronic
1070310869 10:75272959-75272981 ACTGGGCATCAGAGTGAGGATGG + Intergenic
1070501308 10:77075239-77075261 ACTGGAGAGTAGGGAGAGGAAGG - Intronic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1071328444 10:84539091-84539113 GCTGGAAAGCAGAGAGATGAGGG + Intergenic
1071700302 10:87924931-87924953 ACTATACAGAAGAGGGAGGTAGG - Intronic
1071851237 10:89572574-89572596 ACTGAATAGCAGTAGGAGGAAGG + Intergenic
1072391704 10:94994000-94994022 TCTGGACAGCAGAAAAAGGATGG - Intergenic
1073429402 10:103476548-103476570 ACCTGGCAGCAGAGGAAGGAGGG + Exonic
1073702935 10:105950524-105950546 TGTGGCCAGCAGAGGGAGCAAGG + Intergenic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074603860 10:114941063-114941085 AGTGGACAGAGAAGGGAGGAGGG - Intronic
1075378732 10:122000756-122000778 ATTGAACAGTGGAGGGAGGAAGG - Intronic
1075944940 10:126424629-126424651 TATGTACAGCAGCGGGAGGAGGG + Intergenic
1076644660 10:131944666-131944688 ACTGGACAGCAGAGGGAGGACGG - Intronic
1076840663 10:133043728-133043750 CCTGGACAGCACCCGGAGGATGG - Intergenic
1077096794 11:802388-802410 ACAGGAAAGCTGAGTGAGGAAGG + Exonic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077674538 11:4184616-4184638 AGTGGCCAGCAGAGCCAGGAGGG - Intergenic
1078011282 11:7574971-7574993 AAGGGACAGAAAAGGGAGGAAGG - Intronic
1078059256 11:8032817-8032839 ACAGGACAGCCGAGGGCTGAGGG + Intronic
1078185245 11:9046521-9046543 ACAGGATAGCAGACGGGGGAGGG + Intronic
1078550593 11:12277521-12277543 AAAGGACAGCAAAGGGAGAAGGG + Intronic
1078794384 11:14577434-14577456 AGTGGATAGCAGAGGTAGAATGG - Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1079137592 11:17784754-17784776 ACTGCAGTGCGGAGGGAGGAGGG - Intergenic
1079351684 11:19697272-19697294 GCTAGACAGGAGAGGGAGGGAGG + Intronic
1079363003 11:19785221-19785243 ACTTCACAGTAGAGGAAGGAAGG + Intronic
1080590099 11:33715792-33715814 GTTGGACAGCAGAGGTAGGGAGG - Intronic
1080932876 11:36831110-36831132 ACTAGACAGGAGAGGGAAGGAGG - Intergenic
1081734872 11:45395566-45395588 TCTGGACATCAGTGGGATGATGG + Intergenic
1083028378 11:59570092-59570114 AATGGAGGGCAGAGGGAAGAAGG - Intergenic
1083156742 11:60828047-60828069 ACAGGGGAGCCGAGGGAGGAGGG + Intergenic
1084042680 11:66551400-66551422 TCTGGACAGCAGGGGGAATAGGG + Intronic
1084868009 11:72075598-72075620 ACTGAAAAACAAAGGGAGGAAGG - Intronic
1085052893 11:73388888-73388910 ACGGGGCAGCACAGGCAGGAAGG - Intronic
1085198300 11:74685311-74685333 ACTGGAGTGGTGAGGGAGGAAGG - Intergenic
1085235659 11:75013342-75013364 AATGGAGATCAAAGGGAGGATGG - Intronic
1085331848 11:75658695-75658717 AAGGGACAGAAGAGGGAGGTAGG - Intronic
1085393146 11:76192857-76192879 TCTGTACAGGAGAGGCAGGAGGG - Intronic
1085466834 11:76729872-76729894 ACAGCACATCAGAGGGAGGGAGG - Intergenic
1085636642 11:78164379-78164401 AGTGGACCGCAGAGATAGGATGG - Intergenic
1085741410 11:79080910-79080932 ACTAGGAAGCAGAGGGAAGAGGG + Intronic
1086278399 11:85158729-85158751 AATGGACAGCAGAGGCAAAATGG + Intronic
1086329934 11:85743890-85743912 ACTGACCAGCTGAGGGAGGAGGG - Intronic
1086455713 11:86956497-86956519 ACTGGAAAGCAGAGAGAGGGTGG - Intergenic
1087017838 11:93571879-93571901 GCTGGAGAGCAGAGGCAGCATGG + Intergenic
1087313756 11:96581526-96581548 AAAGGATAGCAGAGGGATGAGGG - Intergenic
1088059347 11:105627335-105627357 ACTGGACAGCACTGCGAGGCAGG + Intronic
1088264927 11:107979813-107979835 AATGGACAGCAGAGGGAAAGTGG + Intergenic
1088459019 11:110063208-110063230 ACTGTACAACAGGAGGAGGAGGG + Intergenic
1088821345 11:113460322-113460344 ACTGGGCAGGACAGGGAGGGAGG + Intronic
1089022079 11:115226649-115226671 ACTTGTCTGCAGAGAGAGGACGG + Intronic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089153887 11:116385872-116385894 GCTGGACAGCAGAGGGCCGGGGG - Intergenic
1089590453 11:119537056-119537078 TCAGGACAGCAGATGGAGGATGG + Intergenic
1089597846 11:119593040-119593062 GCTGGAAAGTAGAGTGAGGAAGG + Intergenic
1089810058 11:121124394-121124416 ACAAGAGAGCAGAGGCAGGAGGG - Intronic
1092083472 12:5736863-5736885 AATGGGCAGCAAAGGGAAGAAGG - Intronic
1092227408 12:6756807-6756829 AGAGGAGAGGAGAGGGAGGAAGG - Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1093007282 12:14064292-14064314 ACTGGACGGCAGGTGGAAGAGGG + Intergenic
1094701819 12:32877816-32877838 ACTGAACTGCAGAGTCAGGAGGG + Intronic
1096042983 12:48536233-48536255 ACTTGAGAGCAGAGGGAGGGAGG + Intergenic
1096530990 12:52242843-52242865 ACCAGACAGCAGTGTGAGGAAGG - Intronic
1096559080 12:52423279-52423301 AGTGGACGGGAGAGGGAGGACGG - Intergenic
1096751103 12:53759300-53759322 AGTGAACAGCATAGGGAGAAAGG + Intergenic
1097736389 12:63186263-63186285 ACTGGAAAGGAGATGGAGGATGG + Intergenic
1097742488 12:63260319-63260341 ACTGGAAAGCAGTGGGAGATAGG - Intergenic
1099007084 12:77247022-77247044 TCTGGACAGGAAAGGGAGTATGG - Intergenic
1099395001 12:82127042-82127064 ACTTGACAGTGGAGGGTGGAAGG + Intergenic
1099619725 12:84986924-84986946 ACTGGAAAGGAAAGAGAGGAAGG + Intergenic
1100148101 12:91701843-91701865 AGTGGAAAGCAAGGGGAGGAGGG + Intergenic
1100815044 12:98378777-98378799 TCTGGATATCAGGGGGAGGAGGG - Intergenic
1100836394 12:98570978-98571000 ATTGGACGGCAGGAGGAGGATGG + Intergenic
1101835862 12:108295071-108295093 ACTGGAATGCAGAGAGAAGATGG + Intronic
1102251423 12:111389978-111390000 ACTGGGCAGGACATGGAGGAAGG + Intergenic
1102372219 12:112391557-112391579 ACTGGAGATCAGAAGGATGAGGG - Intergenic
1102698496 12:114818263-114818285 ACATGACAGCAGAGTCAGGAGGG - Intergenic
1102928661 12:116845924-116845946 ACTGGGCAGAAGAGAGGGGATGG - Intronic
1103724565 12:122991281-122991303 ACAGGACAGAACAGGGAGGATGG + Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104769789 12:131354172-131354194 ACTCCTCAGCAGAGGCAGGATGG - Intergenic
1105560795 13:21488749-21488771 ACTGGACAGGAGAGAGTAGATGG - Intergenic
1106050023 13:26181070-26181092 ACTGGAAGGCTGATGGAGGAAGG - Intronic
1106680664 13:32003869-32003891 ACTTGACGGCAGAGGGTGGGAGG + Intergenic
1107606719 13:42064580-42064602 ACTGAGCAGCTGAGGTAGGAAGG + Intronic
1107905384 13:45056700-45056722 ACAGGACAGCAGAGGGACAAAGG + Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109150042 13:58835735-58835757 AGTGGGGAGCAGAGGGAGGGAGG - Intergenic
1110188307 13:72700915-72700937 ACTAGACAGCACAGGGCGGTAGG - Intergenic
1110470793 13:75857475-75857497 ACTGGACAGCTGCAGCAGGAAGG - Intronic
1111447079 13:88360848-88360870 ACAGGAGAGCAGAGTGAGGAGGG - Intergenic
1111450858 13:88413385-88413407 ACTGGAGGGCAGAGGGTGGGAGG + Intergenic
1111917696 13:94378452-94378474 ATTAGACAAAAGAGGGAGGAAGG - Intronic
1112418744 13:99228178-99228200 ACAGGACTGCAGATGGAGCAGGG - Intronic
1113869753 13:113551919-113551941 ACTAGAAAGAAGTGGGAGGACGG + Intronic
1114421217 14:22584878-22584900 ACTGGAAACCAGAGGCCGGAAGG + Intronic
1114568510 14:23649488-23649510 ACTGGACAGCCCAAGGAGCATGG - Intergenic
1116160580 14:41262798-41262820 ACTAGACAGGGGAGGGAGGGAGG - Intergenic
1116741450 14:48760383-48760405 ACTGGTAAGTATAGGGAGGAGGG - Intergenic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1117436929 14:55724399-55724421 ACTGGAGAGAAGAGGGATGCAGG + Intergenic
1118797200 14:69153606-69153628 AGAGGCCAGCAGAGGAAGGAGGG - Intergenic
1118837128 14:69485194-69485216 ACAGGAAAGCAGAGGCACGACGG - Intronic
1119666667 14:76489775-76489797 ACAGGACAGCAGATGGATGGGGG + Intronic
1119754819 14:77108772-77108794 ACTCAAAAGAAGAGGGAGGAGGG - Intronic
1119881128 14:78100838-78100860 ACTGGAAAGGAGAGAGAGGCTGG - Intergenic
1121736529 14:96221789-96221811 ACTGGAGAGGAGAGAGAGGAAGG + Intronic
1122282851 14:100634462-100634484 ACTGAACGGCAGAGGCAGGATGG - Intergenic
1122569030 14:102681750-102681772 ACTTAACATCAGAGTGAGGATGG - Intronic
1124600276 15:31128091-31128113 ACTGGTCAGCAGAGCGGGGAGGG - Intronic
1124624516 15:31300346-31300368 ACGTGACAGCAGAGGGTGGGTGG - Intergenic
1124681566 15:31736056-31736078 ACTGGAGGGCAGAGGGTGGGAGG + Intronic
1125085342 15:35723294-35723316 GCTGGACAGCAGTGGGATGCTGG + Intergenic
1125334405 15:38613443-38613465 TCTTGAGAGGAGAGGGAGGAGGG + Intergenic
1125520925 15:40347466-40347488 ACTGGGCAGCAGCGGCTGGAAGG + Intergenic
1125602917 15:40925472-40925494 ACTGGAGAGAGGAGTGAGGAAGG - Intergenic
1125892488 15:43276770-43276792 ACTGCACAGGAGACTGAGGAGGG + Intronic
1126098618 15:45106495-45106517 GCTGGGCAGAGGAGGGAGGAGGG - Intronic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1126767454 15:52023204-52023226 ACTGGATAGCAGTGGTAAGAAGG - Intronic
1127262349 15:57335550-57335572 GCTGGAGAGCAGAGGGAGAACGG - Intergenic
1127532653 15:59859930-59859952 CCTGTACAGCAGAGAGAAGAGGG - Intergenic
1128034073 15:64507775-64507797 AATAGAGAGCAGAGGGAAGATGG + Intronic
1128066816 15:64770212-64770234 ACTGGAAGGCAGGGGGAGAAAGG - Intronic
1128234807 15:66060073-66060095 GATGGACAGCAGAGGGATGAAGG + Intronic
1128787054 15:70405379-70405401 TCTGAATAGCAGAGAGAGGAAGG + Intergenic
1129866697 15:78914390-78914412 ACTGGCCAAGAGAGGCAGGAAGG + Intergenic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1130719130 15:86369489-86369511 ACTGGAAAGTAGAGGGGGAAAGG + Intronic
1131186571 15:90279294-90279316 ACTGCACAGTGGTGGGAGGAAGG + Intronic
1131200337 15:90390074-90390096 ACTGCACAGTGGTGGGAGGAAGG + Intronic
1131390308 15:92042690-92042712 ACCAGATAGCTGAGGGAGGAGGG + Intronic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1131872715 15:96778295-96778317 ATTGAACAGCAGAGGGTGGGGGG - Intergenic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1132557176 16:577840-577862 ACAGGTCCCCAGAGGGAGGATGG - Intronic
1132710658 16:1265677-1265699 ACAGGAGAGCAGCTGGAGGATGG + Intergenic
1132848212 16:2010504-2010526 TCTGGATGGCAGAGGGAGGGAGG - Intronic
1133589541 16:7229517-7229539 AAAGGAGAGGAGAGGGAGGAAGG + Intronic
1134045053 16:11094715-11094737 ACTACACGGCAGAGGCAGGAGGG - Intronic
1134095468 16:11415707-11415729 ACTGGACAGCAGTGGGAGAAGGG + Intronic
1134188066 16:12099795-12099817 ACTGCACCACAGAGGGAGGTGGG - Intronic
1134825903 16:17284148-17284170 ACAGGACTGTTGAGGGAGGAAGG - Intronic
1135314406 16:21432332-21432354 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1135367328 16:21864608-21864630 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1135444485 16:22506550-22506572 TCTGGATTCCAGAGGGAGGAAGG - Intronic
1135547114 16:23373845-23373867 ACAGGACAGTACAGGGAGGTGGG + Intronic
1135990464 16:27215864-27215886 GCTGGACAGCAGCAGCAGGAGGG + Intronic
1136012447 16:27372588-27372610 AAAGGCCAGCAGAGGGAGGCAGG - Intergenic
1136031194 16:27504301-27504323 AGGGGATGGCAGAGGGAGGAAGG + Intronic
1136103648 16:28013349-28013371 GCTGGCGAGCAGAGGGAGGTGGG + Intronic
1136221078 16:28829384-28829406 ATTGGACTGGGGAGGGAGGAAGG - Exonic
1136230647 16:28883471-28883493 AATGGACCGAGGAGGGAGGAGGG - Intronic
1136311075 16:29411027-29411049 TCTGGATTCCAGAGGGAGGAAGG + Intergenic
1136324519 16:29512818-29512840 TCTGGATTCCAGAGGGAGGAAGG + Intergenic
1136439204 16:30252799-30252821 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1137366537 16:47864388-47864410 ATTGGAAAGGAGAGGAAGGAAGG + Intergenic
1137386708 16:48048795-48048817 GCTGCACAGCCCAGGGAGGAAGG - Intergenic
1137430614 16:48415343-48415365 ACTGGAAGGCAGATAGAGGATGG + Intronic
1137500278 16:49005655-49005677 ACTGGAGAGCAGAGTGAGAAGGG + Intergenic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139516002 16:67452757-67452779 CCTGGACTGCACAGGGAGGTAGG - Intronic
1139532975 16:67552502-67552524 AGGGGACAACAGAGGGAGGGAGG + Intergenic
1139777016 16:69322708-69322730 ACTTGACAGGGGAGGGAAGAGGG + Intronic
1140124362 16:72107592-72107614 ACGGGACAGTAGAGGAAAGAAGG - Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140572786 16:76128299-76128321 ACTTGAGAGCAGAGGGCGGGAGG - Intergenic
1140766554 16:78164857-78164879 ACTGTAAAGCAGAGGAAGGTGGG + Intronic
1140775249 16:78243509-78243531 ACTGGAGGGTAGAGGGTGGAAGG - Intronic
1141076560 16:81011086-81011108 AGGGGACAGCAGAGACAGGAAGG - Intronic
1141163138 16:81642485-81642507 ACAGGACAGCACAGGGTGTAAGG - Intronic
1141496065 16:84410546-84410568 CCTAGACAGCAAACGGAGGAGGG - Exonic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141979903 16:87543604-87543626 ACTGGGCAGGAGAGGGCCGAGGG + Intergenic
1141988086 16:87593002-87593024 AGAGGAGAGGAGAGGGAGGAGGG - Intergenic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142092459 16:88221847-88221869 ACGGGACAGCAGAGGCAGAGTGG - Intergenic
1142112451 16:88339685-88339707 ACAGGATGGCAGAGGGAGGGGGG + Intergenic
1142199875 16:88755982-88756004 CCAGGACAGCAGAAGAAGGAAGG + Intronic
1142372479 16:89690826-89690848 ACCAGACAGGAGGGGGAGGAGGG - Intronic
1142489064 17:266272-266294 ACTGGGGAGCACAGGGATGATGG - Intronic
1142804278 17:2363317-2363339 GCTGGAGAGCAGAGGGTGGCTGG + Intronic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1143456671 17:7072276-7072298 ACTGGACGGCGGAGGCAGGGAGG - Intergenic
1144630929 17:16872067-16872089 ACTGGGCACCAGAGGGCAGATGG - Intergenic
1144650387 17:17003409-17003431 ACTGGGCACCAGAGGGCAGATGG + Intergenic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1146489058 17:33266879-33266901 ACAGAACAGCAGAGTGAGGTGGG + Intronic
1146531509 17:33611177-33611199 TCTGGACAGGAGAGGGGGAAAGG - Intronic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146907330 17:36626138-36626160 ACAGCATAGCAGAGGCAGGATGG - Intergenic
1146938231 17:36825818-36825840 TCTAGCCAGCAGAGGGAGGTGGG + Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147355380 17:39891854-39891876 ACTGGAAAGGAGAGAGAAGAAGG + Intergenic
1147911344 17:43858040-43858062 AGTAAACAGCAGAGGGAGGAGGG - Intronic
1148045072 17:44738463-44738485 CCTGCACAGAGGAGGGAGGAGGG + Intronic
1148236661 17:45973746-45973768 CCTTCACAGCAGAGGCAGGAGGG - Intronic
1148582282 17:48752348-48752370 AGGTGACAGGAGAGGGAGGAAGG + Intergenic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1148738426 17:49878208-49878230 AGTTGACAGGAGAGGGAAGAGGG + Intergenic
1148946149 17:51263061-51263083 ACTGGACAGGTGAGGCAAGATGG - Intronic
1149060770 17:52419072-52419094 ACTGCACAGCATTGGTAGGATGG + Intergenic
1151113603 17:71707171-71707193 ACTTGATATCAGAGGAAGGAGGG - Intergenic
1151157002 17:72132050-72132072 AATGCAGAGGAGAGGGAGGAGGG + Intergenic
1152095485 17:78269482-78269504 GCTGGAGAGGAGAGGGTGGACGG + Intergenic
1152142501 17:78545147-78545169 ACTGGCCAGAGGAGGGAGGCGGG - Intronic
1152244654 17:79178957-79178979 ACTGGCCAGCGGAGGGAGGAGGG - Intronic
1152562453 17:81085372-81085394 ATGGGACAGCAGAGGAAGGAGGG + Intronic
1152730601 17:81967823-81967845 CCTGGACAGGTGAGGGAGGCTGG + Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1153847971 18:9066874-9066896 ACTGAACAGCATAGTGAAGAGGG - Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1155940918 18:31801228-31801250 ACTGCACAGCAGAGGGCCAAAGG - Intergenic
1156615937 18:38784194-38784216 ACTGGATAGCAGAGAGATGTTGG - Intergenic
1156713355 18:39975739-39975761 AGTGAACAGCAGAGGGATAATGG - Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157413794 18:47485510-47485532 ACTGCACAGCATGGGGAGGGAGG + Intergenic
1157965729 18:52206164-52206186 ACAGGTGAGCAGAGGGAGCAAGG + Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158587688 18:58755813-58755835 ACTGGCCAACAGAGAGTGGAGGG + Intergenic
1159379896 18:67643481-67643503 CCTGGACAACAGAGGGAGACTGG - Intergenic
1159913895 18:74172060-74172082 GGGGGACAGCAGAGAGAGGAGGG - Intergenic
1159914716 18:74178382-74178404 ACCAGGAAGCAGAGGGAGGAAGG + Intergenic
1160053710 18:75460192-75460214 ACAGGATTGCAGATGGAGGAAGG + Intergenic
1160152628 18:76406652-76406674 ACAGGCCAGCAGAGCCAGGAAGG - Intronic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160932463 19:1577158-1577180 ACTGGGCAGCAGGGCCAGGAGGG + Exonic
1161271180 19:3390182-3390204 TCTGGACAGCAGAGGGGTGAGGG + Intronic
1161322294 19:3646893-3646915 ACAGGAGGACAGAGGGAGGAAGG + Intronic
1162067178 19:8132945-8132967 ACTGGCCAGCGGAGGGGAGAAGG - Intronic
1162104468 19:8362049-8362071 AGTGGACAGGAAAGGGAGGGAGG - Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162788489 19:13051050-13051072 ACTTGGCAGTGGAGGGAGGAGGG + Intronic
1163345198 19:16736818-16736840 ACTGATCAGCAGAGGGAAGTAGG + Intronic
1163627983 19:18401880-18401902 AGTAGACAGCAGAGGGAGCAGGG + Intergenic
1163786174 19:19275972-19275994 ACTGTGCTGCAGAGGGAGGTTGG - Intergenic
1164097347 19:22023416-22023438 AATGGACAGCAGAGGCAAAATGG - Intergenic
1164200239 19:23012131-23012153 AATGGACAGCAGAGGCAAAATGG - Intergenic
1164892185 19:31833656-31833678 ACTAGAGGGGAGAGGGAGGAGGG - Intergenic
1164983081 19:32628589-32628611 ACTGTACAGCAGAGGCAGCTGGG + Intronic
1166368961 19:42291084-42291106 ACTGGACAGCAGGGGGCGCAGGG - Exonic
1166597115 19:44059730-44059752 ACTGAACAACTGAGGCAGGAAGG - Intronic
1166705422 19:44905650-44905672 ACAGCAGGGCAGAGGGAGGAAGG - Intergenic
1166919227 19:46217452-46217474 GCTGCATAGCAGAGGCAGGAAGG + Intergenic
1167411738 19:49348067-49348089 TCTGGCCAGCAGATGGAGGAAGG - Intronic
1167680648 19:50918118-50918140 ACTCTACAGAAGAAGGAGGATGG + Intergenic
1168135342 19:54347343-54347365 ACTAGACAGCAGGGCCAGGAGGG - Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925258403 2:2509024-2509046 AATGGACAGCAGACAAAGGAAGG - Intergenic
925298896 2:2795968-2795990 ACAGATCAGCAGAGGGAGGGAGG - Intergenic
925789810 2:7472537-7472559 ACTGAGCAGGAGATGGAGGAGGG - Intergenic
926766790 2:16329188-16329210 ACTTCACTGCAGAGTGAGGAAGG - Intergenic
927096247 2:19749711-19749733 ACCTGACAGCTCAGGGAGGAAGG - Intergenic
927108900 2:19850454-19850476 GCTGCAGAGCAGAGGGAGCAGGG - Intergenic
927513317 2:23658084-23658106 AGTGGGCAGGAGAGGGAGGAGGG - Intronic
927605479 2:24482835-24482857 ATTGGTCAGCAGAGATAGGAAGG + Intergenic
927848380 2:26483744-26483766 AAGGGACAGCTGAGGGAGCAAGG + Intronic
928411401 2:31057127-31057149 ACTAGACAGGAGAAGGAGGGAGG + Intronic
928413502 2:31072141-31072163 ACCCCACAGCAGAGGGAAGATGG - Intronic
929610812 2:43269442-43269464 ACTGGCCAGCAGATCGAAGACGG + Intronic
930752477 2:54946348-54946370 ACAGGACAGGAGTGCGAGGAAGG - Intronic
931006699 2:57857954-57857976 ACTAGACAGGGGAGGGAGGGAGG - Intergenic
932354834 2:71060144-71060166 ACTGGACAGAAGAAAGAGGACGG - Intergenic
932595799 2:73092846-73092868 ACTGGGTTGCAGAGGGAGGTGGG - Intronic
932924212 2:75952834-75952856 ACTGGAAAGCAGAGGAAATAAGG - Intergenic
933389517 2:81652474-81652496 TCTGCTCAGCAGAGAGAGGATGG - Intergenic
933804465 2:85988027-85988049 ACTGCCGGGCAGAGGGAGGATGG + Intergenic
934056212 2:88253395-88253417 ACTGGAAGGGAGAGAGAGGAAGG - Intergenic
934150574 2:89144148-89144170 ACTGGACAACCGAGGGTGAAAGG - Intergenic
934216704 2:90037880-90037902 ACTGGACAACCGAGGGTGAAAGG + Intergenic
934986297 2:98888364-98888386 ACAGCACAGAAAAGGGAGGAGGG + Intronic
935069840 2:99684367-99684389 ACTGGACAGCTGCAGGGGGAGGG - Intronic
935377150 2:102411201-102411223 ACTGGACAGCAGCAGGAAGAAGG - Intergenic
936408030 2:112225789-112225811 CCTGGACAACAGAGTGAGCATGG + Intronic
937785420 2:125889457-125889479 AATGGACAGCAGAGGCAACAAGG - Intergenic
938707534 2:133945354-133945376 TCTAGCCAGCAGAGGAAGGAGGG + Intergenic
939523321 2:143260845-143260867 AATGGAGAACAGAGGAAGGATGG - Intronic
941353016 2:164459128-164459150 TCTGGAAAGCAGAGGCAGGTTGG - Intergenic
941773190 2:169364329-169364351 ACCGGACCGGAGCGGGAGGAGGG + Intergenic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
941918545 2:170828051-170828073 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941918554 2:170828089-170828111 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941918562 2:170828126-170828148 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918574 2:170828172-170828194 TGAGGACAGCAGAGAGAGGAGGG - Intronic
941918587 2:170828244-170828266 TGAGGACAGCAGAGAGAGGAGGG - Intronic
941918600 2:170828294-170828316 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
941918628 2:170828406-170828428 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918659 2:170828548-170828570 TGAGGACAGCAGAGGTAGGAGGG - Intronic
941918675 2:170828620-170828642 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918681 2:170828643-170828665 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918699 2:170828710-170828732 TGAGGACAGCAGAGGGAGAAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918710 2:170828756-170828778 TGAGGACAGCAGAGGTAGGAGGG - Intronic
941918715 2:170828779-170828801 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
941918768 2:170829023-170829045 TGAGGACAGCTGAGGGAGGAGGG - Intronic
945139825 2:206673077-206673099 ACTGGAGGGCAGAGGGTGGGAGG - Intronic
945448614 2:209967544-209967566 ACTGGACAGCTGAGGCAGTGAGG + Exonic
945518441 2:210792738-210792760 ACTGTACAGTAGAGAAAGGAAGG - Intergenic
946040181 2:216776290-216776312 AGTTGACAGCGGAGGGAGGAAGG + Intergenic
946154914 2:217801010-217801032 ACTGGCCAGGAGAGGGATGGTGG - Exonic
946832773 2:223742884-223742906 AATGGAGAGCATGGGGAGGATGG - Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
948010106 2:234645671-234645693 AGTAGACAGCAGTGGGAGTAGGG - Intergenic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948159312 2:235811263-235811285 CCTGGACATCAGAGGCAGGAGGG - Intronic
948186606 2:236026296-236026318 CCTGGCCAGCACAGGGAGCAGGG - Intronic
948200718 2:236128102-236128124 ACTGGCAAGCTGAGAGAGGAGGG - Exonic
948759802 2:240183573-240183595 ATTAGACAGCAGAGGTGGGACGG - Intergenic
948807843 2:240460632-240460654 AGAGGGCAGCAGAGGGAGGGCGG - Intronic
948862410 2:240759068-240759090 ACAGGGCAGAAGAGTGAGGAGGG + Intronic
1168824148 20:797945-797967 TCCGCACAGCAGAGAGAGGATGG + Intergenic
1169059841 20:2653220-2653242 ACTGCGCCGCAGAGGCAGGAGGG + Intronic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1170269990 20:14515683-14515705 ACTGGTTAGCAGAGGCTGGATGG + Intronic
1170282160 20:14661878-14661900 ACTGGTCATCAGTGGTAGGATGG + Intronic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1170598245 20:17821509-17821531 AGTGGACAGCACATGAAGGATGG + Intergenic
1171323007 20:24263276-24263298 ACTAGAGAGGAGAGGGAGAAAGG - Intergenic
1171374836 20:24685420-24685442 AGTGGAGAGCAGGGGGAGGGAGG - Intergenic
1171824238 20:29879327-29879349 ACTGGATAGAGGAGGGAGGAGGG + Intergenic
1172122312 20:32605742-32605764 ACGGGACAGCAGAGAAGGGAGGG - Intronic
1172581734 20:36053675-36053697 ACCTGAGAGAAGAGGGAGGAGGG + Intergenic
1172621383 20:36320318-36320340 CCAGGACAGCAGAGGAGGGAGGG - Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1174157984 20:48528926-48528948 TGTGGACAGCAGAGGGATGGAGG + Intergenic
1174795297 20:53517271-53517293 ACTGGACAGCAGGAGGTGAATGG + Intergenic
1175156996 20:56977846-56977868 TCTGTAGAGCAGAGGGAGGGAGG - Intergenic
1175160171 20:57002502-57002524 AGTGGACAGGAGAGGAAGGAAGG - Intergenic
1175520588 20:59600155-59600177 ACTGGACATGCAAGGGAGGAAGG - Intronic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1175814538 20:61876706-61876728 ACTGGAAACCAGAGGGAGGGCGG - Intronic
1176074586 20:63242753-63242775 ACATGACAGCAGAGGGAACATGG + Intronic
1176310128 21:5145049-5145071 GCTGGACTCCAGTGGGAGGAGGG - Intronic
1176429541 21:6567432-6567454 ATTGGAGAGCCGAGGAAGGATGG - Intergenic
1177072743 21:16531261-16531283 ACTTGACAGCAGAGTGGAGAAGG - Intergenic
1177261766 21:18738535-18738557 ACTAGAGATCAGATGGAGGAAGG + Intergenic
1177542123 21:22507815-22507837 ACTAGACAGTGGAGGGAGGAAGG - Intergenic
1177591297 21:23171744-23171766 ACTGCATAGCAGAGGGCAGAGGG + Intergenic
1178032008 21:28538643-28538665 ACTAGACAGGGGAGGGAGCAAGG - Intergenic
1178553959 21:33569727-33569749 ACTGGAAGCCTGAGGGAGGATGG + Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179088406 21:38241312-38241334 ACTCCACTGCAGAGGGAGGGTGG - Intronic
1179226363 21:39456639-39456661 ACGGCACAGCTGTGGGAGGAGGG + Intronic
1179556723 21:42183189-42183211 ACTGGTCAGCTGAGGGATGAGGG + Intergenic
1179704935 21:43174894-43174916 ATTGGAGAGCCGAGGAAGGATGG - Intergenic
1179846928 21:44116987-44117009 GCTGGACTCCAGTGGGAGGAGGG + Intronic
1180592651 22:16954313-16954335 ACGGGGCTGCAGTGGGAGGAGGG + Intergenic
1180949126 22:19713414-19713436 ACGGGCCAGCAGAGGGACCAAGG + Intergenic
1181372802 22:22431664-22431686 TCTGGACACCAGAGGGCGCATGG + Intergenic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181473742 22:23156343-23156365 ACTGGACTCCAGGGGGAGGTCGG + Intronic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1181844976 22:25699614-25699636 ACTGCACAGCTGTGGGAGGAGGG - Intronic
1182980966 22:34670643-34670665 GCAGGACATCAGAAGGAGGAAGG - Intergenic
1183278846 22:36921623-36921645 ACTGGCAAGCAGAGGGTGGGGGG + Intronic
1183441063 22:37823430-37823452 ACTGGACAGCCCAGGGAGTGTGG + Exonic
1183578377 22:38706556-38706578 GCGGGACAGCAGAGGGGCGAGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1184033110 22:41906239-41906261 ACAGGACAGCCAGGGGAGGAGGG + Exonic
1184985546 22:48130868-48130890 ACGGGGCTGCAGAGGGAGGCGGG - Intergenic
949822416 3:8130395-8130417 AATGGATATCAGAGGTAGGAAGG - Intergenic
950206991 3:11088498-11088520 ACGGGACAACAATGGGAGGATGG - Intergenic
950297543 3:11845185-11845207 ACTGGAGAGAAGAGGGACTAAGG + Intronic
950451623 3:13068663-13068685 ATTGGGCCACAGAGGGAGGATGG - Intronic
950594347 3:13965637-13965659 ACTGGACAGCAGAGAGGGGATGG - Intronic
950706519 3:14785832-14785854 AGTGGAGAGCGGAGGCAGGAAGG - Intergenic
951292865 3:20894830-20894852 ATTGCACAGTAGAGTGAGGATGG + Intergenic
951796732 3:26547404-26547426 ACTTGACAGTAGATGGAGGTGGG - Intergenic
952315738 3:32230695-32230717 ACTGGACAGCAGACGAGGCATGG - Intergenic
952712035 3:36441241-36441263 ACTGGCAAGCACAGGGAGAAGGG - Intronic
953274633 3:41482763-41482785 ACTTGTCTGCAGAGAGAGGAAGG - Intronic
953714872 3:45308608-45308630 GCTGGACCACAGAGGGAGGTGGG + Intergenic
954464908 3:50648637-50648659 GCTGGACTGCACAGGGAGGCAGG - Exonic
954626074 3:52022576-52022598 ACTGCCCAGCAGAGGAAGGACGG - Intergenic
954899303 3:54005500-54005522 ACTGGCCAGCAGGGGCAGAAGGG - Intergenic
955702470 3:61695530-61695552 ACTGGATATCAGAGGTAGAAAGG - Intronic
956223755 3:66933369-66933391 AAGGGACTGCAGGGGGAGGATGG - Intergenic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
956877307 3:73476389-73476411 ACTAGACAGCACTAGGAGGATGG + Intronic
957201341 3:77139983-77140005 ACTGCAAACCAGAGGCAGGAGGG + Intronic
957550201 3:81694505-81694527 ACTGGAGAGTAGAAGGAGGCGGG - Intronic
958774811 3:98469278-98469300 ACTTGACAGTGGAGGGTGGAAGG + Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958908703 3:99969623-99969645 ATTGGAGAGCAGAGGTAGTAAGG + Intronic
959452439 3:106520233-106520255 AGTACACAGCAGTGGGAGGAAGG + Intergenic
960254832 3:115500967-115500989 TCTGGAAAACAGTGGGAGGAAGG + Intergenic
960534440 3:118801148-118801170 ACTTGACTGAAGAGGGAGAAAGG - Intergenic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961577959 3:127853968-127853990 GCTGGAACGCAGAGGGAGCATGG + Intergenic
961627216 3:128272404-128272426 ACTGGACATTGAAGGGAGGAAGG + Intronic
961982529 3:131096178-131096200 ACTAGATAGGGGAGGGAGGAAGG - Intronic
961987586 3:131154117-131154139 GCTAGACAGGAGAGGGAGGCAGG + Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
963628286 3:147701348-147701370 AGTGCACAGAAGAGGGAAGAAGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964134003 3:153323976-153323998 ACTGGACGGGAGAGTGGGGAAGG - Intergenic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
964858701 3:161175729-161175751 ACAGGAAAGCAGAGGGAGGCTGG + Intronic
965710063 3:171548295-171548317 CCTGGGCAACAGAGGGAGAATGG - Intergenic
966770694 3:183501100-183501122 ACAGGTCAGCAGAGTGGGGATGG + Intronic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967768633 3:193310016-193310038 ACTTGAGAGCAGAGGGTGGGAGG - Intronic
967840072 3:193998009-193998031 TATGAACAGCAGAGGGAGGAGGG + Intergenic
968485879 4:861346-861368 AGTGGGCAGCTGAGGAAGGAGGG + Intronic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
969370378 4:6727773-6727795 AGGGGACAGGAGGGGGAGGAGGG - Intergenic
969725620 4:8916460-8916482 ACTGCACAGCACAGCGAGGCTGG - Intergenic
971022174 4:22548037-22548059 CCTGGGCAGCACAGGGATGATGG - Intergenic
972613504 4:40676640-40676662 ACTTAACAGCAGACGGAAGATGG - Intergenic
972852935 4:43072637-43072659 TCTGGACAGTAGAAAGAGGATGG + Intergenic
974357079 4:60826103-60826125 ACTGGACAGCAGAAGTACTATGG - Intergenic
974654021 4:64796397-64796419 ACAGGACTGAAGAGGGAGTAGGG - Intergenic
974834247 4:67228166-67228188 ATTGGACAGTGGAGGGTGGAAGG + Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975448037 4:74490575-74490597 GCTGGACAGGGGATGGAGGAGGG - Intergenic
975939774 4:79628877-79628899 AATGCACAGCAGGGGAAGGAAGG - Intergenic
976144891 4:82032753-82032775 TCCTGACACCAGAGGGAGGAAGG - Intronic
979567476 4:122171253-122171275 ACTAAATAGCAGAGGGAGAAAGG + Intronic
979937078 4:126711205-126711227 AATGGAAAGGAGAGGTAGGATGG + Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981076627 4:140598856-140598878 TCTGGACAGCAGAAAAAGGATGG - Intergenic
981227886 4:142318269-142318291 AGTGGAAGGCAGAGGAAGGAAGG + Intronic
981627157 4:146771406-146771428 ACTGGAGGGCAGAGGGTGGTAGG - Intronic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985504788 5:272467-272489 ACAGGCCAGGAGAGGAAGGAAGG + Intronic
985743327 5:1633128-1633150 ACAGGCCAGGAGAGGAAGGAAGG - Intergenic
985851631 5:2392649-2392671 GGAGGACAGAAGAGGGAGGAAGG - Intergenic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986299304 5:6465955-6465977 CCTGGGCAGCAGAGGGAGACAGG - Intronic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986764925 5:10916722-10916744 GCTGGAAAGAAAAGGGAGGATGG + Intergenic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
989613580 5:43317805-43317827 TCCGCACAGCAGAGAGAGGATGG - Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990044365 5:51410989-51411011 TCTGAACAGCAGAGAGACGAGGG + Intergenic
991993837 5:72367786-72367808 ACTGCACTGCATAGGGAGGCAGG + Intergenic
993139001 5:84006567-84006589 ACTTGAGAGCAGAGGTTGGAAGG + Intronic
994645699 5:102466174-102466196 ACTGGAGGGCAGAGGGTGGGGGG - Intronic
995025924 5:107422607-107422629 ACTGGATAGGAGAGGGAGGAGGG + Intronic
995425333 5:112015055-112015077 TCTGGAGAGCAGAAGGAGGTTGG + Intergenic
996326438 5:122280142-122280164 ACTAGAGAGGAGAGGGAGGGAGG - Intergenic
996570386 5:124927536-124927558 AAAGGACAGCAGAGTGAGGCTGG - Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
996848261 5:127924652-127924674 ACCTGACAGTAGAGGCAGGATGG + Intergenic
997592493 5:135084180-135084202 ACTGGAAAGCAGATGGATGAGGG - Intronic
997658699 5:135574063-135574085 TCTGGGCAGCAGAGGGAGTGGGG + Intronic
998162346 5:139820738-139820760 GCTGCCCAGCAGAGGAAGGACGG + Intronic
998178112 5:139914456-139914478 CCTGGAAAGCAGCGAGAGGAAGG - Intronic
998904242 5:146887291-146887313 ATTGGACAGCAGAGGTACAATGG + Intronic
999070346 5:148737498-148737520 ACTGGACTTCTGAGGGAGAAAGG + Intergenic
999076855 5:148804509-148804531 AAATGACAGCAGGGGGAGGAGGG + Intergenic
999562396 5:152818839-152818861 ACAAGACAGCAGAGTGAAGATGG + Intergenic
999891282 5:155981067-155981089 ACAGTGCAGCAGATGGAGGAGGG + Intronic
1000115726 5:158151735-158151757 CCTGGGCAACAGAGCGAGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1001123018 5:168995722-168995744 ACAGGGAAGCAGAGGGAGCAGGG - Intronic
1001966641 5:175914349-175914371 ACAGCACAGCAGAGGGAGGAGGG + Intergenic
1002250306 5:177924855-177924877 ACAGCACAGCAGAGGGAGGAGGG - Intergenic
1002372595 5:178767170-178767192 ACTGGCTGGCACAGGGAGGATGG - Intergenic
1002427838 5:179186328-179186350 GCTGGACAGCAGAAGGAGCCCGG - Intronic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1003520493 6:6854545-6854567 AGTGGTCTGCAGAGAGAGGAAGG - Intergenic
1003560307 6:7174409-7174431 ACAGGACAGCAAGGAGAGGATGG - Intronic
1003709100 6:8569070-8569092 ACTTGAGGGTAGAGGGAGGAAGG - Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004570125 6:16836778-16836800 ACTGGACTGAACATGGAGGAGGG - Intergenic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1006336103 6:33421152-33421174 GATGGACAGCAGAGGAGGGAGGG - Intronic
1006400692 6:33815426-33815448 ACAGGCCAGGGGAGGGAGGATGG + Intergenic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1006635440 6:35458203-35458225 ACTGGACAGCAGACAGAGCAGGG - Intronic
1006979014 6:38131644-38131666 AGGGGACAACAGTGGGAGGAAGG - Intronic
1007258228 6:40543476-40543498 AGAGGACAGCAGAGTTAGGATGG - Intronic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007936676 6:45738511-45738533 ACTGGACAGAAAAGGGTGCAAGG + Intergenic
1008571441 6:52820970-52820992 ACAGGACAGCAGTAGGAGAATGG + Intergenic
1008756021 6:54796526-54796548 ACTGGATAACAGACTGAGGATGG + Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010252610 6:73723737-73723759 ACTGGAGGGTAGAGGGAGGGAGG + Intronic
1010443378 6:75924962-75924984 ACTGGGGAGGGGAGGGAGGAGGG + Intronic
1010765240 6:79771226-79771248 TCTGGACATCTGAGGGAGGAAGG + Intergenic
1010777996 6:79908764-79908786 ACTGGATAGCTGAGGTAAGATGG + Intergenic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1011640757 6:89413932-89413954 ACAGGAGAGTGGAGGGAGGATGG - Intergenic
1011720596 6:90152135-90152157 CATGGACAGCAGAGGCAGAAAGG - Intronic
1012435815 6:99214321-99214343 ACTAGAGGGAAGAGGGAGGAAGG + Intergenic
1014048626 6:116925567-116925589 ACTGGATGGCAGAGGGAGATAGG - Exonic
1014957277 6:127636378-127636400 ACTAGACAGGAGAGGCTGGAGGG - Intergenic
1015686370 6:135867578-135867600 ACTGGACGGTAGAGGGTGGGAGG - Intronic
1015993632 6:138975116-138975138 TCTGGGCAGCAGAGTTAGGAGGG - Intronic
1016865179 6:148759199-148759221 AGTGGCCAGGAGAGGGAGAAAGG + Intronic
1016998950 6:149982198-149982220 ACTAGACAGGGGAGGGAGGAGGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017305086 6:152908834-152908856 ACTTGACGGTAGAGGGATGAAGG - Intergenic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1018090751 6:160345758-160345780 ACTGCATTGCTGAGGGAGGAAGG + Intergenic
1018343096 6:162872641-162872663 ACAGGAAAGAAGAGGGAGGGAGG + Intronic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1019109035 6:169694993-169695015 CCCGGCCAGCAGAGGGAGAAGGG + Intronic
1019501621 7:1367659-1367681 ACAGGCCAGCCGAGGCAGGAAGG + Intergenic
1019801968 7:3094513-3094535 ACTGGAAACCAGAAGGAGGCGGG + Intergenic
1019904470 7:4050413-4050435 ACTCGACAGGAGAGGGAAGAAGG - Intronic
1021628873 7:22623908-22623930 ACTCTACAGCAGAAGTAGGAAGG + Intronic
1021807742 7:24373849-24373871 ACTGGCCAGCAGTGACAGGAAGG - Intergenic
1023740752 7:43278627-43278649 ACTGGAGTGGAGAGAGAGGAGGG - Intronic
1023748352 7:43344606-43344628 AAAGGACAGCAGAGAGATGATGG - Intronic
1023770001 7:43548526-43548548 AGTGGAGAGCAGAGGGATGCAGG + Intronic
1023795437 7:43788245-43788267 ACTGGAAGACAGAGGCAGGAGGG + Intronic
1023844972 7:44115472-44115494 ACTGGCCTGCAATGGGAGGAGGG - Intronic
1023878852 7:44307356-44307378 AGTTGTCAGCAGGGGGAGGAGGG + Intronic
1023949605 7:44832443-44832465 ACAGGACAGCTGTTGGAGGATGG + Intronic
1024147365 7:46531244-46531266 ACTGTACATCTCAGGGAGGAGGG - Intergenic
1024469530 7:49752667-49752689 ACAGGAGAGAAGAAGGAGGATGG + Intergenic
1024702162 7:51915831-51915853 ACTAGAGAGCAGAGGGAGAAAGG + Intergenic
1025156112 7:56607020-56607042 AATGGACAGCAGAGGCAAAATGG - Intergenic
1026625454 7:71987958-71987980 ACTGGAGAGCAGTGGGGGAAGGG + Intronic
1026627011 7:72003445-72003467 ACTGCACAGCAGAGGGAGAACGG + Intronic
1026735847 7:72948159-72948181 ACTGGACGGCAGCGGGAGGCTGG + Intronic
1026786190 7:73303090-73303112 ACTGGACGGCAGCGGGAGGCTGG + Intronic
1027107887 7:75416904-75416926 ACTGGACGGCAGCGGGAGGCTGG - Exonic
1027337586 7:77170123-77170145 ACTAGAGAGTGGAGGGAGGAAGG - Intronic
1027987180 7:85308256-85308278 ACAGGGCAGAAGAGGCAGGATGG + Intergenic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028287598 7:89022112-89022134 ACAGGATAGTAGAGGCAGGATGG + Intronic
1028424706 7:90673422-90673444 CCTGGGCAACAGAGGGAGGGAGG - Intronic
1028480316 7:91297438-91297460 ACTGGAGAGCAGAGGAGGGGTGG - Intergenic
1028746322 7:94330899-94330921 ATTGCAGAGCAGAGGGAGAATGG - Intergenic
1029451963 7:100646493-100646515 CCTGGACAGCTGAGCCAGGACGG + Intronic
1029778156 7:102700679-102700701 ACTAGAGAGTGGAGGGAGGAAGG + Intergenic
1030060493 7:105617508-105617530 AGTGGATAGCAGGGGCAGGAGGG + Intronic
1030451221 7:109714619-109714641 ACTGGAGATCAGAGGGTGGGAGG + Intergenic
1030815847 7:114036511-114036533 ACTTCACACCACAGGGAGGATGG - Intronic
1030872591 7:114775261-114775283 ACTGGACCTCAGAGGAAGGATGG + Intergenic
1031206929 7:118771847-118771869 ACTAGCCAGCAGCTGGAGGATGG - Intergenic
1031336168 7:120535585-120535607 ACAGCACAGCAGTGGGAGGCAGG - Intronic
1032410738 7:131692023-131692045 AAAGGAGAGCAGGGGGAGGAGGG - Intergenic
1032434795 7:131890973-131890995 ACTGGACAGTAGAGTCAGTAAGG + Intergenic
1032722151 7:134558976-134558998 TCTGGACAACAGAAAGAGGATGG + Intronic
1032781850 7:135170354-135170376 ACCGGCCCGCAGAGGGAGGGCGG - Intronic
1033097593 7:138444271-138444293 TCCGCACAGCAGAGAGAGGATGG - Intergenic
1033552700 7:142462452-142462474 ACAGGACAGCAGAGGGAGGTAGG - Intergenic
1033989630 7:147267479-147267501 ACAGAACATCAGAGAGAGGAAGG - Intronic
1034226367 7:149486962-149486984 ACTGCACAGCAGGGGGTGGGTGG + Intronic
1034369625 7:150583690-150583712 AGTGAACAGGAGAGGGAGAATGG + Intergenic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034949208 7:155285612-155285634 ACAGAACAGCAGAGGGGTGAGGG - Intergenic
1036104461 8:5825041-5825063 TCCGGACAGCAGAGACAGGATGG - Intergenic
1036127429 8:6075781-6075803 ACTGGACAGGACAGGGATGACGG + Intergenic
1036699376 8:11001888-11001910 GCTGAACAGCAGAGGGACCAGGG - Intronic
1037429580 8:18795400-18795422 ACTGGAGAACAGAGGGATGCTGG + Intronic
1037824268 8:22151675-22151697 ACTGAAGACCAGAGGGAGAAGGG + Intronic
1037915745 8:22772263-22772285 TCTGGGCAGGAGAGGGAGCAGGG + Intronic
1039200195 8:35082757-35082779 ACAGGACATTAGAGGGAGAATGG - Intergenic
1039301492 8:36214208-36214230 ACTGCCTAGCAGAGGTAGGAAGG - Intergenic
1040073710 8:43208460-43208482 TCTGGACAGCAGAGTGTGGGTGG + Intergenic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1041045346 8:53881884-53881906 ACTGGAAAGCAGGGGGCGGAGGG + Intronic
1041113154 8:54506689-54506711 CCTGGACAGCAGAGGCAGGGCGG - Intergenic
1042242843 8:66681983-66682005 AGAGGAGAGGAGAGGGAGGAAGG - Intronic
1042489058 8:69378403-69378425 ACTGAACAGCTGAGAGAAGATGG - Intergenic
1044119960 8:88382496-88382518 AATGGAGGGAAGAGGGAGGAAGG - Intergenic
1044380809 8:91530960-91530982 ATTGTACAGCAGAGGGAAGGGGG + Intergenic
1044776466 8:95693878-95693900 GGCGGACTGCAGAGGGAGGAGGG - Intergenic
1044954478 8:97465351-97465373 ACTGTACAGCAGAGGCTGGCTGG + Intergenic
1045497725 8:102722337-102722359 AGTGGACAGTGGATGGAGGAAGG - Intergenic
1045504861 8:102771262-102771284 ACTTGGAAGCACAGGGAGGAGGG - Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045990037 8:108296017-108296039 TTAGGACAGCAGAGGCAGGAAGG + Intronic
1047023870 8:120806676-120806698 ACTGGAAAGCATAGGGAGCTGGG - Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1048206297 8:132417924-132417946 AGAGGGCAGCAGAGTGAGGATGG + Intronic
1048729443 8:137421105-137421127 ACTGGAAAGGAGAGAGATGAGGG + Intergenic
1049239241 8:141528580-141528602 AGTGGGCAGAGGAGGGAGGAGGG + Intergenic
1049408137 8:142460733-142460755 TCTGGCCTGGAGAGGGAGGAGGG - Intronic
1049582207 8:143417966-143417988 TCTGGAGAGAAGAGGGAAGAGGG + Intergenic
1049741410 8:144242806-144242828 CCTGGACGGCAGTGGGAAGAAGG + Intronic
1049743426 8:144251969-144251991 ACTGCCCGGCAGAGGAAGGATGG - Intronic
1050334096 9:4574141-4574163 ATAAGACAGCAGGGGGAGGAGGG + Intronic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1052018796 9:23501011-23501033 ACTGGAAAGTAAAGGGATGAGGG - Intergenic
1052382591 9:27788046-27788068 ACAAGACAGCAGTAGGAGGATGG - Intergenic
1052535622 9:29742929-29742951 ACTGGACAGGCAAGGGAGAAGGG - Intergenic
1053169319 9:35867662-35867684 TCTGGCCAGCAGAGGAAGCAGGG + Intergenic
1053748968 9:41234892-41234914 ACTCGATAGAGGAGGGAGGAGGG - Intergenic
1056485225 9:87049870-87049892 ACCAGAAAGCAGAGGGAGGGAGG - Intergenic
1056699416 9:88889617-88889639 AGTGGACAGCACAGGGATGCAGG + Intergenic
1056823745 9:89862726-89862748 AGTGGCCAGCTGAGGCAGGAGGG - Intergenic
1057040159 9:91842200-91842222 AATGGACAGCAGGTGAAGGAAGG + Intronic
1057309828 9:93935167-93935189 AGGGCACAGCATAGGGAGGAGGG + Intergenic
1057439560 9:95073134-95073156 GCAGGACAGCAGAGGGAGCAGGG - Intronic
1057904349 9:98972775-98972797 ACTGGACTGCAGACAGATGAGGG + Intronic
1058539792 9:105999764-105999786 ACAGGTCAGCAGAGGGCTGAAGG + Intergenic
1058749246 9:108022935-108022957 AGTGGAAGGAAGAGGGAGGAGGG + Intergenic
1059331552 9:113538781-113538803 GCTGGACAGGAGAAGGATGAAGG + Intronic
1059650258 9:116309619-116309641 GGAGGACAGGAGAGGGAGGACGG + Intronic
1059696443 9:116734335-116734357 ACAGTGCAGCAGAGGGAGGCAGG + Intronic
1060400462 9:123345939-123345961 ATTGAATAGCAGAGGAAGGAAGG + Intergenic
1060422991 9:123482865-123482887 ACAGGACAGCAGAGGGGGAGGGG + Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061262275 9:129486947-129486969 GCTGGACGTGAGAGGGAGGACGG + Intergenic
1061321763 9:129835384-129835406 ATTGGACGGCAGAGGGAAGGAGG + Intronic
1061769080 9:132903821-132903843 ATTGTAAAGCAGAGGGAGGGTGG + Intronic
1061835364 9:133325244-133325266 ACAAGAAAGCAGAGAGAGGATGG + Intergenic
1062005054 9:134234869-134234891 GCTGGACAGGAAGGGGAGGAGGG - Intergenic
1062093271 9:134689741-134689763 ATTGGCCAGCAGAGGGGGCACGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062367530 9:136218382-136218404 CCTGGAGAGTAGATGGAGGAGGG - Intronic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1203377306 Un_KI270442v1:385772-385794 ACTCGATAGAGGAGGGAGGAGGG + Intergenic
1185462007 X:337595-337617 ACAGGACGGCAGAGCAAGGACGG + Intronic
1186028179 X:5337205-5337227 ACTGGACAGCACTAGGAGGATGG + Intergenic
1186426584 X:9467450-9467472 TCAGGAAAGCAGTGGGAGGATGG - Intronic
1187626312 X:21117989-21118011 ACTATACAGCAGAGGCAGAATGG - Intergenic
1187706319 X:22013033-22013055 ATTAGACAGCAGATGGAGGAAGG + Intergenic
1187757789 X:22546037-22546059 ACTGGCAAGTAGAGGGATGATGG - Intergenic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1187989960 X:24859517-24859539 CCTGGACAGCTGAGTGAAGAAGG - Intronic
1188004858 X:25010233-25010255 GCTGCACAACAGAGGGAAGAGGG - Intronic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1189161114 X:38809900-38809922 AATGCAGAACAGAGGGAGGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1190057624 X:47190979-47191001 TCTGGACAGCATTTGGAGGAGGG + Intronic
1190600134 X:52083374-52083396 ACTGGAGGGCAGAGGGTGGGAGG - Intergenic
1190805382 X:53831008-53831030 GCTGGAAAGGGGAGGGAGGAAGG - Intergenic
1190909120 X:54755950-54755972 ACAGGACAGGAGAGGAAGCAGGG + Intronic
1190913296 X:54791084-54791106 CCTGGGCAGGAAAGGGAGGATGG + Exonic
1192369603 X:70502321-70502343 ACAGGAATGAAGAGGGAGGAGGG - Exonic
1194401890 X:93447640-93447662 ACTGCATAGAAGAGAGAGGAAGG - Intergenic
1195479288 X:105324230-105324252 AATGGAGTACAGAGGGAGGAAGG + Intronic
1195706348 X:107740651-107740673 GGTGTACAACAGAGGGAGGATGG + Intronic
1195783544 X:108490796-108490818 ACTTGAGAACAGAGGGTGGAAGG - Intronic
1196976571 X:121164182-121164204 ACTGGAGAGTGGAGGGAGGAGGG - Intergenic
1197270777 X:124422777-124422799 AGTGGAGGGCAGGGGGAGGATGG + Intronic
1197402745 X:126011759-126011781 ACTGGACAGAATAGAGAGCACGG + Intergenic
1197425971 X:126297358-126297380 AATGGACAGCAGAGGCAACATGG - Intergenic
1197477584 X:126943075-126943097 AATGGACAGCAGAGGGAAAGAGG - Intergenic
1197651869 X:129073934-129073956 ACTGCACATCAGAGGAAGCATGG + Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1197852427 X:130877416-130877438 AAAGGACAGAAGAGGGAGGAAGG - Intronic
1197873686 X:131083215-131083237 AGAGGACAGCAGAGGGGTGAGGG + Exonic
1198063208 X:133068247-133068269 ACTTGAGGGTAGAGGGAGGAAGG + Intronic
1198223383 X:134623310-134623332 CTTGGACACAAGAGGGAGGATGG + Intronic
1198855083 X:141007132-141007154 GCAGGACAGCAGAGGGAGAGGGG + Intergenic
1198876930 X:141238008-141238030 GCAGGACAGCAGAGGGAGTGGGG - Intergenic
1198907608 X:141580237-141580259 GCAGGACAGCAGAGGGAGAGGGG - Intergenic
1198909183 X:141594187-141594209 GCAGGACAGCAGAGGGAGAGGGG + Intronic
1198917894 X:141693964-141693986 GCAGGACAGCAGAGGGAGTGGGG - Intronic
1199209327 X:145188262-145188284 ATTGGACAGAAGATGGAGAATGG + Intergenic
1199260999 X:145774843-145774865 ACTGGAGAGAAGAGGAAGAAAGG - Intergenic
1199596527 X:149510333-149510355 ACTGGAAAGAAGAGGAAGGAAGG - Intronic
1200077759 X:153560071-153560093 ACTGGACAGCACACAGGGGAAGG + Intronic
1200211598 X:154349075-154349097 GCAGGACACCAGCGGGAGGAAGG - Intronic
1200775207 Y:7164440-7164462 AGAAGAAAGCAGAGGGAGGAAGG - Intergenic
1201710164 Y:16982549-16982571 ACTAGAAAGCAGAAGGAGAAAGG - Intergenic