ID: 1076646277

View in Genome Browser
Species Human (GRCh38)
Location 10:131957206-131957228
Sequence CCTTCATCTCCACAGGCGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 25, 2: 16, 3: 14, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076646277_1076646284 14 Left 1076646277 10:131957206-131957228 CCGTCCGCCTGTGGAGATGAAGG 0: 1
1: 25
2: 16
3: 14
4: 178
Right 1076646284 10:131957243-131957265 TCCTGCTGCTGTGGAGATGGAGG 0: 1
1: 1
2: 4
3: 55
4: 550
1076646277_1076646282 11 Left 1076646277 10:131957206-131957228 CCGTCCGCCTGTGGAGATGAAGG 0: 1
1: 25
2: 16
3: 14
4: 178
Right 1076646282 10:131957240-131957262 TCCTCCTGCTGCTGTGGAGATGG 0: 1
1: 1
2: 4
3: 55
4: 414
1076646277_1076646281 5 Left 1076646277 10:131957206-131957228 CCGTCCGCCTGTGGAGATGAAGG 0: 1
1: 25
2: 16
3: 14
4: 178
Right 1076646281 10:131957234-131957256 GTTGATTCCTCCTGCTGCTGTGG 0: 1
1: 1
2: 2
3: 29
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076646277 Original CRISPR CCTTCATCTCCACAGGCGGA CGG (reversed) Intronic
900554466 1:3272837-3272859 CCTTCATCGGCACAGGCAGCAGG - Intronic
904050012 1:27633334-27633356 CCATCATCACCACAGTCGGAAGG + Intronic
904146692 1:28398435-28398457 ACTTGAACCCCACAGGCGGAGGG + Intronic
904808216 1:33146504-33146526 CCTTCCTGCCCACAGGCCGAGGG - Exonic
908474215 1:64471767-64471789 CCTTCCTCTCCCGAGGAGGACGG - Intronic
908520473 1:64936305-64936327 CCCTCAACTCCACAGGCCCATGG + Intronic
908654403 1:66372682-66372704 TGTTCATCTCCACAGGGAGAGGG - Exonic
910050800 1:82972101-82972123 CCTTCATATCCACAGGAGATTGG - Intergenic
910594595 1:88966083-88966105 CATTCATCACCTCAGGGGGATGG - Intronic
912601073 1:110933934-110933956 CTTTCCTCTCCTCAGGCAGAAGG - Intergenic
916213365 1:162375691-162375713 CCTGCATCTCATCACGCGGATGG + Intronic
1062835833 10:635254-635276 CCTTCATATCCACAGCCAGCTGG - Intronic
1063369633 10:5512638-5512660 ACCTCATCTCCAAAGGCGCACGG - Intergenic
1066420218 10:35258461-35258483 CCTTCATTTCCAGAGGAGGAGGG + Intronic
1067173758 10:43928047-43928069 ACATCATCTCCACAGGGGAAAGG + Intergenic
1069698345 10:70404317-70404339 GCTTCGGCTCCTCAGGCGGACGG - Intergenic
1069989873 10:72308645-72308667 CCTCCAGCTCCACAGAGGGAAGG + Intergenic
1075047353 10:119156594-119156616 CCTTCATCTCCAGAGGCACCTGG - Intronic
1076646268 10:131957169-131957191 CCTCCATCTCCACAGGGGCACGG - Intronic
1076646277 10:131957206-131957228 CCTTCATCTCCACAGGCGGACGG - Intronic
1076646287 10:131957280-131957302 CCTTCATCTAGACAGGGTGACGG - Intronic
1076646319 10:131957432-131957454 CCTTCATCTAGACAGGGGGATGG - Intronic
1076646335 10:131957506-131957528 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646345 10:131957543-131957565 CCTTCATCTCCACAGGGGCACGG - Intronic
1076646354 10:131957580-131957602 CCTTCATCTCCACAGGGAGATGG - Intronic
1076646361 10:131957616-131957638 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646381 10:131957690-131957712 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646391 10:131957727-131957749 CCTTCATCTCCACAGGGAGATGG - Intronic
1076646403 10:131957764-131957786 CCTCCATCTCCACAGGGGCGCGG - Intronic
1076646411 10:131957800-131957822 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646421 10:131957837-131957859 CCTTCATCTCCACATGGGGATGG - Intronic
1076646440 10:131957907-131957929 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646449 10:131957944-131957966 CCTTCATCTTCACAGGGAGATGG - Intronic
1076646460 10:131957981-131958003 CCTCCATGTCCACAGGGGCACGG - Intronic
1076646469 10:131958018-131958040 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646479 10:131958055-131958077 CCTTCATCTCCACATGGGGATGG - Intronic
1076646490 10:131958092-131958114 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646499 10:131958128-131958150 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646534 10:131958278-131958300 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646544 10:131958315-131958337 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646556 10:131958352-131958374 CCTTCATCTCCACAGGAAGACGG - Intronic
1076646572 10:131958426-131958448 CCTTCATCCCCACAGGGGGATGG - Intronic
1076646582 10:131958463-131958485 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646594 10:131958500-131958522 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646604 10:131958537-131958559 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646634 10:131958648-131958670 TCTTCATCTCCACAGGGGGATGG - Intronic
1076646643 10:131958685-131958707 CCTTCATCTCCACAGGAGGACGG - Intronic
1076646660 10:131958759-131958781 CCTCCATCTCCACAGGGGGACGG - Intronic
1076646671 10:131958796-131958818 CCTCCATCTCCACAGGGGGACGG - Intronic
1076646681 10:131958833-131958855 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646689 10:131958870-131958892 CCTTCATCTCCACAGTGGGATGG - Intronic
1076646697 10:131958907-131958929 CCTTTATCTCCACAGGGGGATGG - Intronic
1076646707 10:131958944-131958966 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646715 10:131958981-131959003 CCTTCATCTCCACAGTGGGATGG - Intronic
1076646723 10:131959018-131959040 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646733 10:131959055-131959077 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646741 10:131959092-131959114 CCTTCATCTCCACAGTGGGATGG - Intronic
1076646749 10:131959129-131959151 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646769 10:131959203-131959225 CCTTCATCTCCACAGGAGGACGG - Intronic
1076646777 10:131959240-131959262 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646785 10:131959277-131959299 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646793 10:131959314-131959336 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646803 10:131959351-131959373 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646811 10:131959388-131959410 CCTTCATCTCCACAGTGGGATGG - Intronic
1076646819 10:131959425-131959447 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646840 10:131959499-131959521 CCTTCACCTCCACAGGGGGATGG - Intronic
1077410382 11:2401112-2401134 CCTTCATGTCCGTAGGCTGAAGG - Intronic
1079259152 11:18861106-18861128 TCTCCACCTCCACAGGAGGAAGG - Intergenic
1082796246 11:57380067-57380089 CCTTCATCTTAACAGGTGGGTGG + Intronic
1084446903 11:69209076-69209098 CCTTCTTCCCCACAAGGGGATGG - Intergenic
1084710831 11:70842897-70842919 CCTTCCACTCCACAGGCTCAGGG + Intronic
1091501044 12:1018327-1018349 CCAGCAGCTCCACAGGCTGAGGG - Intronic
1092030125 12:5276943-5276965 CCTTCATCCCCACAGGGGCCAGG - Intergenic
1094817539 12:34202996-34203018 CCTTCCTCTCCTCAAGCAGAAGG - Intergenic
1098748128 12:74265734-74265756 CCTTCCTCTCGATAGGCGGGGGG - Intergenic
1101549437 12:105748410-105748432 CTTTCTTCTCCATAGGCTGAAGG + Intergenic
1104417752 12:128609319-128609341 CCTTCACCTCCCCAGGCTCAAGG + Intronic
1108171474 13:47746186-47746208 CAGGCATCTCCACAGGAGGATGG - Intergenic
1108256007 13:48611766-48611788 CCTTCATCTCCTCAAGCAGAAGG + Intergenic
1108702279 13:52953870-52953892 CCTACATCTCCACAGGCTCTGGG - Intergenic
1109075724 13:57832385-57832407 GCTTCATCCCCACCGGTGGATGG - Intergenic
1110810562 13:79807500-79807522 CCCCCATCTCCACAGGCTGGGGG + Intergenic
1110843224 13:80166313-80166335 CCTTAATTTCCACAGTGGGAAGG - Intergenic
1114173343 14:20296389-20296411 CCTTCATCTGAACAGGGCGACGG - Exonic
1116928732 14:50668516-50668538 CCTTCATCTTCTCAGTCGGCAGG - Intergenic
1117027081 14:51632001-51632023 CCATAATCTCCACATGTGGAGGG + Intronic
1121869383 14:97393204-97393226 CCTTCTTCACCAGAGGGGGAAGG + Intergenic
1121886629 14:97548901-97548923 CCTTCATCTCCCCTGGAGGGAGG + Intergenic
1122083122 14:99280642-99280664 CCTTCAACAACACACGCGGATGG + Intergenic
1130966199 15:88699667-88699689 CGTTCACCTCCCCAGGAGGATGG + Intergenic
1132759303 16:1501099-1501121 CCGTCACCTCCACAGCCTGAAGG - Intronic
1132800317 16:1748878-1748900 CCTCCATCTCCACAGGGGATTGG + Intronic
1133222841 16:4326549-4326571 CCTGCACCTCCACAGGCTTAGGG + Intronic
1135393674 16:22114887-22114909 GCTTGAACTCCAGAGGCGGAAGG - Intronic
1138932951 16:61683823-61683845 CCTTCATCTCCCTAAGAGGAAGG + Intronic
1139352217 16:66343881-66343903 CCTCCATCCCCACAGTCTGAGGG + Intergenic
1141526595 16:84615694-84615716 CATTCAACTACAGAGGCGGAGGG + Intronic
1141797987 16:86287329-86287351 CCTTCCCCTCCACCAGCGGACGG - Intergenic
1142198039 16:88747865-88747887 CCTCCATCTCCAGAGCCGGTGGG - Intronic
1142990383 17:3726399-3726421 CCTCCATCCCCACAGGAGGGTGG + Exonic
1143736170 17:8913375-8913397 TCTTCACCTCCACAGCCAGAAGG - Intronic
1143871249 17:9958672-9958694 CCCTCATCTCCACATGGGGTTGG + Intronic
1146792482 17:35760174-35760196 ACTTCATCTCAACAGATGGAGGG + Intronic
1149062351 17:52437744-52437766 CCTTCAACTCCTCAAGGGGATGG + Intergenic
1151055619 17:71027639-71027661 CCTTGATCTCCCCAGGCTGAAGG + Intergenic
1152798102 17:82317745-82317767 CCTGCATCTCCACAGGGAGGAGG + Intergenic
1155049724 18:22136061-22136083 CATTCATCCCCACAGAAGGAAGG - Intergenic
1159119135 18:64149153-64149175 CCTTCATGGCCACTGGTGGAAGG + Intergenic
1159152465 18:64537533-64537555 CCATCATCTTCAGAGGGGGAAGG - Intergenic
1161296008 19:3520482-3520504 TCCTCATCTGCACAGGCGGTGGG + Intronic
1161395824 19:4044397-4044419 CCTTAATCTCAAAAGGCGGGGGG + Exonic
1162674571 19:12289222-12289244 CCTTGACCTCCCCAGGCTGAGGG - Intronic
1165511383 19:36268576-36268598 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165511931 19:36271099-36271121 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165512483 19:36273600-36273622 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165513030 19:36276141-36276163 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165513586 19:36278696-36278718 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165514136 19:36281230-36281252 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165514688 19:36283767-36283789 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165515240 19:36286300-36286322 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165515790 19:36288836-36288858 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165516341 19:36291373-36291395 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165516893 19:36293899-36293921 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165517446 19:36296422-36296444 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165517998 19:36298957-36298979 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165518549 19:36301492-36301514 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165519098 19:36304024-36304046 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165519648 19:36306539-36306561 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165520197 19:36309067-36309089 CCTTCATCTCCAAGGCCCGAGGG - Intergenic
1165623871 19:37269515-37269537 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165624416 19:37272055-37272077 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165624961 19:37274582-37274604 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165625497 19:37277120-37277142 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165626033 19:37279645-37279667 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165626577 19:37282172-37282194 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165627116 19:37284697-37284719 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165627659 19:37287221-37287243 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165628194 19:37289745-37289767 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165628735 19:37292270-37292292 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165629276 19:37294796-37294818 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165629818 19:37297321-37297343 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165630361 19:37299849-37299871 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1165630897 19:37302387-37302409 CCTTCATCTCCAAGGCCCGAGGG + Intergenic
1166345271 19:42161744-42161766 CCTTCATCTTCAGGGGCAGAAGG + Intronic
1168309872 19:55455037-55455059 CCTTCCTCTCCACCAGCGAAGGG - Exonic
925677986 2:6386428-6386450 CAGTCACCTCCACAGGAGGAGGG - Intergenic
925927694 2:8681971-8681993 CCTTCGTCCCCATTGGCGGAAGG - Exonic
927138533 2:20114452-20114474 CATCCTTCTCCAGAGGCGGAAGG + Intergenic
932836703 2:75044806-75044828 CCTTCATCTTCAAAGGTGAAAGG - Intergenic
933764068 2:85695277-85695299 GCTTCCCCTCCGCAGGCGGAAGG - Intronic
936357812 2:111766636-111766658 CCTTCAACCCCACATGCGGGAGG + Intronic
937147466 2:119659857-119659879 CCTTCCTCTCCACAGAAGCAGGG - Intronic
938110373 2:128560249-128560271 CCTTCATCCACACAGACAGATGG - Intergenic
938592566 2:132753612-132753634 CCATCATTTCTACAGGTGGAAGG - Intronic
945090164 2:206170862-206170884 TCTTCACCTCCACAGTTGGATGG + Intergenic
947738653 2:232474456-232474478 CCCTCCTCTCCACAGGGAGAAGG + Intergenic
948534672 2:238637160-238637182 CCTCCATCTAGACAGGAGGACGG - Intergenic
948966100 2:241381528-241381550 CCCTCTTCTCCACAGCTGGAAGG + Intronic
1172391449 20:34567998-34568020 CCTTTCTCTCCACAGACCGAGGG + Intronic
1173866880 20:46317918-46317940 CTTTCATCTCCACAGGCTCCAGG - Intergenic
1183105765 22:35613979-35614001 CGTCCATTTCCACAGGCTGAGGG - Intronic
1183343795 22:37295984-37296006 TCCTCATGTCCACAGCCGGATGG + Exonic
1183604727 22:38861647-38861669 GCGTCTTCTCCACAGGGGGAGGG + Exonic
1183784454 22:40021512-40021534 GCATCATCTCCCCAGGCGGGTGG - Exonic
1184194254 22:42916256-42916278 CCTTCAGCTCCACAGTCACAAGG + Intronic
1184737474 22:46407919-46407941 CCTTCAGATGCACAGGCAGAGGG + Intronic
955391594 3:58526214-58526236 CCTGCTTCTCCACAGGCAGCCGG - Intronic
957085780 3:75675328-75675350 CCTTCCTCTCCTCAAGCAGAAGG + Intergenic
958748771 3:98169483-98169505 CCTGCATCTCCGCAAGCAGATGG + Exonic
958840026 3:99192127-99192149 CCATCACCTCCACAGGCCTATGG - Intergenic
961481677 3:127184497-127184519 CCCTCAGATCCACAGGTGGAGGG + Intergenic
965350024 3:167600143-167600165 CTTTCCTCTCCTCAAGCGGAAGG + Intronic
967228354 3:187314399-187314421 CCTTCATCTCCGAAGAAGGAAGG + Intergenic
972832514 4:42831310-42831332 CCATCATCCCCACATGTGGAAGG - Intergenic
975032871 4:69644484-69644506 CCTTCATATCCTCAGGTGTATGG - Intronic
976728444 4:88239658-88239680 CCATCACCTCCACAGGCCCAAGG + Intergenic
980360917 4:131754380-131754402 CCTTCATCTCCAAAGCCCGGGGG - Intergenic
980362000 4:131759335-131759357 CCTTCATCTCCAAAGCCCGGGGG - Intergenic
981107754 4:140900582-140900604 TTTTCATCCCCACAGGCAGATGG + Intronic
981531279 4:145756024-145756046 CCTTCGTCCCCACAGACTGAAGG + Intronic
985528568 5:420629-420651 CCATCCTCTCCACATGGGGAAGG - Intronic
985539264 5:480267-480289 CCTTCAGGTGCACAGGAGGAAGG + Intronic
990786356 5:59424704-59424726 CCTTAATCTCCACATGCTGTGGG - Intronic
998447518 5:142210179-142210201 CCTTGATCTCCCCAGGCTCAAGG - Intergenic
998456980 5:142281035-142281057 CCTTCCTCTCCACAAACCGAGGG - Intergenic
1001180384 5:169514592-169514614 CAGTCATCTCCACAGCTGGAGGG - Intergenic
1001676481 5:173521905-173521927 CCTTCATCTCCATAGGCTCTTGG + Intergenic
1003308059 6:4946666-4946688 CCATCAGCCCCACAGGCGCAAGG - Intronic
1010855632 6:80834948-80834970 TCTTCAGGTCCACTGGCGGAGGG + Intergenic
1012818880 6:104059573-104059595 CCTTCATGCCAACAGGTGGATGG + Intergenic
1014169635 6:118264658-118264680 CCTTCAGCTCCACTGACTGAGGG + Intronic
1014295470 6:119612121-119612143 CCCACTTCTCCACAGGCTGATGG + Intergenic
1015742831 6:136475863-136475885 CCTTCATTGCCACATGCGCAAGG - Intronic
1016800879 6:148167861-148167883 CCTGCATCTGCTCAGGCTGAGGG + Intergenic
1017014458 6:150088907-150088929 CCTTAAGCTCCACAGTGGGAGGG + Intergenic
1018708045 6:166477048-166477070 CCTTCACCTGCACAGGCGGCCGG - Intronic
1020997487 7:15281384-15281406 GCTGCATCTCCACAGGAGAAGGG + Intronic
1023117254 7:36874635-36874657 GCTTCATCTCCACATGGGCAGGG + Intronic
1025175191 7:56796486-56796508 CCTCCCTCTCCACAGGATGAGGG + Intergenic
1025696610 7:63779928-63779950 CCTCCCTCTCCACAGGATGAGGG - Intergenic
1028160971 7:87484137-87484159 CCTTCACCACCACAGGCCCAGGG - Intergenic
1029737404 7:102472478-102472500 CCTCCAGCTCCACAGGCAGATGG - Exonic
1031472368 7:122182343-122182365 CCCTCCTCTCCTCAGGCAGAAGG - Intergenic
1033138677 7:138806033-138806055 CTTTCATCTGCACAAGAGGAAGG + Exonic
1034567130 7:151924252-151924274 CCTTCACCTCTTCAGGCCGAGGG + Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035344952 7:158191805-158191827 CCCTCATGCCCACAGGCAGATGG + Intronic
1035771658 8:2152438-2152460 ACTAGATCTCCACAGGCAGAGGG - Intronic
1038449468 8:27630308-27630330 CCTTTATCACCACAGGGGCAGGG + Intergenic
1038603265 8:28970653-28970675 CTTTCATCTCCAAAGGTGGGAGG - Intronic
1039910059 8:41819460-41819482 CCTTCATTGCCACAGGTGGAAGG + Intronic
1040903670 8:52442525-52442547 CCTCCATCTCCTCAGTTGGATGG - Intronic
1045464914 8:102460978-102461000 TCTTCATCTTCGCAGGTGGAAGG - Intergenic
1047023203 8:120798907-120798929 CATTCAACTCCACAGGCTGCAGG + Intronic
1047511322 8:125517954-125517976 CCTTGATCTCCACAGTTAGAAGG + Intergenic
1048707408 8:137169367-137169389 CCTTCATGTCCACAGCAGAAAGG + Intergenic
1048920940 8:139229489-139229511 CATTCATCTCCGCAGACTGAGGG - Intergenic
1049957661 9:708316-708338 CTTTCATCTCCACATGGAGAAGG - Intronic
1050508270 9:6369448-6369470 CCTTCATCACCCCAGGCCCATGG - Intergenic
1051602922 9:18892374-18892396 TCTTCCTCTCCCCAGGTGGATGG + Exonic
1051882889 9:21858219-21858241 TCTTCATGTCCACAGCCGAAGGG - Intronic
1051940614 9:22501295-22501317 CCATAATCCCCACATGCGGAGGG - Intergenic
1056795858 9:89658484-89658506 CCTTCATCTGTACAGACTGACGG + Intergenic
1060593795 9:124835695-124835717 CATTCATCTCCACTGTCGGAAGG - Intergenic
1060992897 9:127858790-127858812 TCTTCATCTGCACAAGGGGAGGG + Intergenic
1061779591 9:132987772-132987794 CCTTCATCACCTCATGTGGAGGG - Intronic
1061925278 9:133803174-133803196 CCTTCATCTCCACATACGCAGGG + Intronic
1062035858 9:134382232-134382254 CCTTCCTCCCCACATGCGGCCGG - Intronic
1187756468 X:22532693-22532715 CCTTCATATCCATAGGGGAATGG + Intergenic
1190911189 X:54774134-54774156 CATTCTTCTCCATAGGTGGAAGG + Exonic
1190920026 X:54842061-54842083 CATTCTTCTCCATAGGTGGAAGG - Intergenic
1191849324 X:65574386-65574408 CCTTAATCTGCACAGGAGGAAGG + Intergenic
1195872153 X:109497770-109497792 CTTTCCTCTCCACAGGCAGAAGG + Intergenic
1196517645 X:116631690-116631712 CCTTCACCCCCACAGGCCCATGG - Intergenic