ID: 1076648794

View in Genome Browser
Species Human (GRCh38)
Location 10:131972824-131972846
Sequence GGCTGGACACTCAGCTGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076648794_1076648796 -10 Left 1076648794 10:131972824-131972846 CCCGCTCAGCTGAGTGTCCAGCC 0: 1
1: 0
2: 3
3: 34
4: 271
Right 1076648796 10:131972837-131972859 GTGTCCAGCCCATGTGCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 106
1076648794_1076648800 14 Left 1076648794 10:131972824-131972846 CCCGCTCAGCTGAGTGTCCAGCC 0: 1
1: 0
2: 3
3: 34
4: 271
Right 1076648800 10:131972861-131972883 TGTTCCCACCCACAGTTTCTTGG 0: 1
1: 1
2: 0
3: 23
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076648794 Original CRISPR GGCTGGACACTCAGCTGAGC GGG (reversed) Intronic
900104352 1:976005-976027 GGCTGGATCCTCAGGTGAGTCGG + Exonic
900563562 1:3320820-3320842 GGCTGGAGCCCCAGCTGAGCAGG - Intronic
900761268 1:4472699-4472721 GGCTGGAGACTCAGGAAAGCTGG - Intergenic
901263103 1:7888224-7888246 GGCTGGAAACACAGCTTAGGTGG - Intergenic
901637590 1:10677496-10677518 GGCTGGACACGGAGCTAAGGAGG + Intronic
902286171 1:15409985-15410007 AGCTGGCCACCAAGCTGAGCCGG + Exonic
902644904 1:17791240-17791262 GGCTGTACACTCCGTGGAGCTGG - Intronic
902866954 1:19285992-19286014 GACTGGAGCCTCACCTGAGCAGG - Exonic
904303551 1:29571969-29571991 GACTTGACACTCACCGGAGCAGG + Intergenic
904435526 1:30492455-30492477 GGCTGCACACTCAGATCACCTGG + Intergenic
904675690 1:32198004-32198026 AGCTGGAGAATCAGCTCAGCAGG - Exonic
906435021 1:45788067-45788089 GGCTGGAGAATCAGCGGAGGAGG + Intronic
906612772 1:47214671-47214693 GCCTGACCACTCAGCTGCGCTGG + Intergenic
907459351 1:54596127-54596149 GGCTGGCCACTCAGCTTCACTGG + Intronic
909594481 1:77390463-77390485 TTCTGGACACTCAGGTGAGAGGG + Intronic
911375267 1:97044123-97044145 GGCTGGGGACTCAGGTGAGGAGG + Intergenic
911715942 1:101133185-101133207 GGCTGCACCCACAACTGAGCAGG - Intergenic
912460763 1:109829424-109829446 GGCTGGAAGCCAAGCTGAGCTGG + Intergenic
912722747 1:112033874-112033896 GGCTGGACACCCAGGAGAGCTGG + Intergenic
915342944 1:155186102-155186124 GGCTGGCCACTCAGCTCAGCGGG + Exonic
915738019 1:158096801-158096823 GGCTGGACATGCAGCTGGGGAGG - Intronic
916241399 1:162643573-162643595 GGCAGGAGAATCACCTGAGCCGG - Intronic
916674395 1:167053926-167053948 TGCTGGGCACACAGGTGAGCAGG + Exonic
917056901 1:170992635-170992657 GGCAGGCCTCTCTGCTGAGCTGG + Intronic
917537022 1:175881756-175881778 GGCTGGAAACTCAGCAGACCAGG - Intergenic
917848937 1:179043459-179043481 GGCTGCACACTCCACGGAGCTGG - Intronic
922468346 1:225860226-225860248 GGCTGGACAGGCAGCTGCGCTGG + Intronic
1062917943 10:1256271-1256293 TGCTGGCCACTCAGCTGTGCAGG - Intronic
1063169691 10:3496459-3496481 CGCTGGACACGGGGCTGAGCTGG - Intergenic
1064661303 10:17610578-17610600 GGCTGAGCAGTGAGCTGAGCTGG + Intronic
1065201582 10:23317486-23317508 GGCTGTACACTCTACTAAGCTGG - Exonic
1066039793 10:31536839-31536861 GGCTTGACATTCACCTGAGATGG + Intergenic
1066227606 10:33399096-33399118 AGCTGGAGACTCAGAAGAGCTGG + Intergenic
1066300534 10:34091852-34091874 GGCTCCACAGTCAGCTGACCTGG - Intergenic
1069632122 10:69903306-69903328 GACTGGACCTTCAGCTCAGCTGG - Intronic
1069753590 10:70760439-70760461 TGCAGGACACACAGCAGAGCCGG - Exonic
1069774364 10:70918184-70918206 GGCTGGGCACTGGGCTGGGCAGG + Intergenic
1070314096 10:75294680-75294702 GGGAGGACACTGAGCGGAGCGGG + Intergenic
1070816697 10:79328885-79328907 TGCTGGTGACTCACCTGAGCTGG + Intergenic
1071251488 10:83823997-83824019 GTCAGGGCAATCAGCTGAGCAGG - Intergenic
1071458359 10:85868524-85868546 TGTTGGATGCTCAGCTGAGCAGG - Intronic
1071933430 10:90499496-90499518 TGTCGGAAACTCAGCTGAGCTGG + Intergenic
1072030733 10:91519812-91519834 GGCAGGAGACTCAGCTAAGTTGG - Intergenic
1072739028 10:97898559-97898581 GGCTGGAGACGCAGCCAAGCTGG + Intronic
1073017492 10:100413091-100413113 GACAGGATGCTCAGCTGAGCAGG - Intergenic
1075741286 10:124698032-124698054 GGCTGAGCTCTCAGCTGTGCAGG - Intronic
1076648794 10:131972824-131972846 GGCTGGACACTCAGCTGAGCGGG - Intronic
1076655352 10:132019937-132019959 GGCTGCACACTCCACAGAGCCGG - Intergenic
1077143920 11:1036456-1036478 GGCTGGTCACGGAGCCGAGCTGG + Intronic
1077218912 11:1406674-1406696 TGCTGGACACACAGCTGTCCTGG - Intronic
1077483013 11:2825348-2825370 GGAAGGACACTGAGCTGAGCAGG - Intronic
1077704666 11:4473094-4473116 GGCAGGACAGTCACGTGAGCCGG + Intergenic
1079224759 11:18595673-18595695 GGCTGGAGCCTCAGAAGAGCTGG + Intergenic
1079393974 11:20045606-20045628 GGCTGGAGACTGGTCTGAGCCGG - Exonic
1080682602 11:34490360-34490382 GGCTGGGCTCTGAGCTGGGCCGG + Intronic
1082027897 11:47586183-47586205 GGCTGGACAGACAGATCAGCTGG - Intergenic
1082895314 11:58183858-58183880 GGAAGGACACTCAGCTGATCAGG - Intergenic
1083000388 11:59285734-59285756 GGCTGGGCAGTCAGGAGAGCAGG + Intergenic
1084372916 11:68756460-68756482 GGCTGGTCACCAAGGTGAGCCGG + Exonic
1085123791 11:73983605-73983627 GGCTGGACAGGCAGCTGGCCTGG - Intergenic
1085316624 11:75548915-75548937 GGCTGGGCACTCACCTGGGCTGG - Intergenic
1088305726 11:108405232-108405254 GGTTGGACACTCAGCAGGACTGG + Intronic
1089571022 11:119409868-119409890 GTCTGAAGCCTCAGCTGAGCTGG + Intergenic
1091384496 12:84232-84254 GGCTGGGCACTGAGATGAGTGGG - Intronic
1091586851 12:1821600-1821622 GGCTGGACACTGAGCTTGGGTGG + Intronic
1091843601 12:3637951-3637973 CGCATGACACTCAGCTAAGCAGG + Intronic
1092289909 12:7153847-7153869 AGCTGGACACTCAGGGGAGAAGG - Intronic
1093150578 12:15616546-15616568 GCCTGGACGCTCAGTTGAACTGG - Intergenic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1096971530 12:55670384-55670406 GGCTGGGCCCTCAGCTCAGAAGG - Intergenic
1097240167 12:57569651-57569673 AGCTGGAGGCTGAGCTGAGCCGG + Exonic
1097513871 12:60578089-60578111 GGTCGGACACTCAGCTGGACTGG + Intergenic
1098328917 12:69332247-69332269 GGCTGGACACTCAGCTGGACTGG - Intergenic
1099749578 12:86755740-86755762 GGCTGGAGAGTCACCTGAGCTGG - Intronic
1100782996 12:98049163-98049185 TGCTGGAGACTCAGGAGAGCTGG - Intergenic
1101366733 12:104078801-104078823 GGCTGGGCAGTCAGCTGAGAAGG + Intronic
1102632211 12:114290964-114290986 GACTGGGGACTCAGCTGAGGGGG - Intergenic
1102677490 12:114668534-114668556 GGCTGGACACAAGTCTGAGCAGG + Intergenic
1103360484 12:120350672-120350694 GGCTGGCTCCGCAGCTGAGCTGG + Intronic
1104954572 12:132457915-132457937 GGGTGGACAGGCAGGTGAGCGGG + Intergenic
1105870557 13:24502290-24502312 GCCTGTAAACTCAGCTGAGATGG - Intronic
1106402730 13:29445274-29445296 CACTGGACACTCAGCTGATGAGG - Intronic
1109717981 13:66241954-66241976 GGTTGGAAACTGAGGTGAGCAGG + Intergenic
1111354569 13:87080715-87080737 AGCTGCACACTCCGCAGAGCAGG - Intergenic
1112158904 13:96848358-96848380 GCTTGGACACTCAGCTGGACTGG - Intergenic
1112423591 13:99276188-99276210 TGCTGGACACTCAGAAGAACTGG - Intronic
1113456673 13:110454550-110454572 GACCGGACACGCAGCTGACCTGG + Intronic
1113770175 13:112903202-112903224 GGGTGGCCACTGAGCTGAGAAGG + Intronic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1117243623 14:53861260-53861282 GCCTGGACTCTGAGCAGAGCTGG - Intergenic
1118446163 14:65852981-65853003 TGCTGGAAACTCAGCTAACCTGG - Intergenic
1119749898 14:77069788-77069810 GGCTGCACACCCACGTGAGCGGG - Intergenic
1122453935 14:101835108-101835130 TGCTGGACAGTCGGCTGTGCTGG - Intronic
1122597806 14:102905216-102905238 TGCTGGAGTCCCAGCTGAGCCGG + Exonic
1122635119 14:103126232-103126254 GGCTGGACACACAGCTATGCTGG - Intronic
1124992636 15:34691156-34691178 GGGTGGAGACTCATCTGAGGTGG + Intergenic
1125573311 15:40737709-40737731 GGCAGGTCTCTCACCTGAGCTGG - Exonic
1126644527 15:50861648-50861670 GGCTGGCCCCTCAGCTGGGAAGG - Intergenic
1127584992 15:60369986-60370008 GGCTGGACACTTAGCTGCTATGG - Intronic
1129242592 15:74260362-74260384 GGATGGACGCTCATCTGAGAAGG + Intronic
1129331620 15:74830751-74830773 GGCTGGACACGCAAGGGAGCTGG - Exonic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1131150490 15:90044459-90044481 AGCTGGACCGACAGCTGAGCTGG + Intronic
1131313520 15:91312116-91312138 ATCTCTACACTCAGCTGAGCAGG - Intergenic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132601629 16:775485-775507 GGTTGGCCAAGCAGCTGAGCTGG + Exonic
1132841215 16:1979277-1979299 GGCTGGGCGCTCTCCTGAGCGGG - Exonic
1133075133 16:3274273-3274295 GGCTGGAGCTTCAGCTGAGGTGG + Intronic
1134569642 16:15280297-15280319 GGTTGTACAGTCAGCTGAGCTGG + Intergenic
1134732737 16:16475752-16475774 GGTTGTACAGTCAGCTGAGCTGG - Intergenic
1134934705 16:18236216-18236238 GGTTGTACAGTCAGCTGAGCTGG + Intergenic
1135341181 16:21649442-21649464 GGCTGGAGATGGAGCTGAGCTGG - Intronic
1139481712 16:67234348-67234370 GGGTGGACACCCAGGTGAGTAGG - Exonic
1140666929 16:77236273-77236295 GGCTGGGCACTGAGCCGGGCTGG + Intergenic
1142266706 16:89067253-89067275 TGCTTGTCACTCAGGTGAGCAGG + Intergenic
1142743357 17:1942947-1942969 GGCTGTAACCTCAGCTCAGCTGG + Intronic
1143408143 17:6691629-6691651 AGCTGGAGACTGTGCTGAGCTGG + Intronic
1144673643 17:17147067-17147089 GGCAGCACAGACAGCTGAGCAGG - Intronic
1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG + Intergenic
1145218028 17:21066803-21066825 GGCAGGACAGTAAGCAGAGCCGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147526327 17:41227134-41227156 AGCTGGACACACAGGTGGGCTGG - Exonic
1147527358 17:41238486-41238508 AGCTGGACACACAGGTGGGCTGG - Exonic
1147528477 17:41250140-41250162 AGCTGGACACACAGGTGGGCTGG - Exonic
1147529007 17:41255850-41255872 AGCTGGACACACAGGTGGGCTGG - Exonic
1148865515 17:50626264-50626286 AGTTGGACACGGAGCTGAGCTGG + Exonic
1148873425 17:50672427-50672449 GGCAGGACACCAAGCTGGGCAGG + Intronic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149864167 17:60141241-60141263 GGCTGCACACTCAGCTGGCCTGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151756803 17:76079892-76079914 GGCTGGACACTCGCCTGGCCTGG + Exonic
1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG + Intergenic
1152024650 17:77801051-77801073 GGCTGGACACTCACCTTCGGTGG + Intergenic
1152091248 17:78249095-78249117 GGCTGGACTCTGCGCTGAGTAGG + Intergenic
1152437310 17:80284267-80284289 GGCAGGATAATCACCTGAGCTGG + Intronic
1153770575 18:8412380-8412402 GCCTGGGCATGCAGCTGAGCCGG - Intergenic
1161976037 19:7608090-7608112 GCCTGGCCACTCACCTGACCTGG + Intronic
1163469901 19:17489983-17490005 GCCAGGTCACACAGCTGAGCAGG + Intronic
1163612227 19:18307637-18307659 GGCTGGAGACTTAGGTGACCTGG - Intronic
1163842135 19:19618064-19618086 GGCAGGAGAATCAACTGAGCCGG + Intronic
1165130368 19:33628307-33628329 GGCTGGAGACCCATCTGTGCAGG + Intronic
1166976044 19:46605596-46605618 GGCTGGACACTCAGGCCTGCTGG - Intronic
1167606038 19:50481653-50481675 GGCAGGGCACTCAGCACAGCAGG - Intronic
926114615 2:10204538-10204560 GGCTGGGCACAGCGCTGAGCAGG - Intronic
926134742 2:10328653-10328675 AGCTGGAGACTCAGGAGAGCCGG - Intronic
929598508 2:43190807-43190829 GGCTGGCCCCTCAGCTTATCTGG - Intergenic
930603698 2:53470575-53470597 GGCTGCACCCACAGCTGGGCAGG + Intergenic
930775677 2:55167756-55167778 CTCTAGACACTCAGCTGACCTGG + Intergenic
932278317 2:70468302-70468324 TGCTGGACCCTCCTCTGAGCAGG + Intronic
935095129 2:99936826-99936848 GGCTGGTGTCTCAGCTGAGGGGG - Intronic
935484861 2:103640608-103640630 GGCTGGACCTGCAGCTGAGGAGG - Intergenic
941131207 2:161651869-161651891 TTCTGCCCACTCAGCTGAGCAGG - Intronic
942093136 2:172513444-172513466 GCCTGGACACTCAGCTGGACTGG + Intergenic
943820686 2:192315809-192315831 GGTTGGAGCCTCAGCTGAGGCGG - Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
948729525 2:239954100-239954122 GGGTGGTCACTCAGCTGGCCTGG - Intronic
948729548 2:239954197-239954219 GGGTGGTCACTCAGCTGGCCTGG - Intronic
948729571 2:239954295-239954317 GGGTGGTCACTCAGCTGGCCTGG - Intronic
948747472 2:240106994-240107016 GACTGGACACCGAGCTGAGCGGG - Intergenic
948806035 2:240453706-240453728 GTCTGGACACGCAGCAGCGCCGG - Intronic
1172844136 20:37919669-37919691 GCCTTGCCACCCAGCTGAGCTGG + Intronic
1173130474 20:40388235-40388257 GGCTGGAGGGTCAGCTGGGCTGG - Intergenic
1174263291 20:49313112-49313134 GGCTGGTGCCTCAGCTGAGATGG - Intergenic
1175227602 20:57453883-57453905 GGCTGGAGACTCGGCTGCCCAGG - Intergenic
1175855467 20:62118674-62118696 GGCTGGACAGTAAGGTGAGGAGG - Intergenic
1175905364 20:62376883-62376905 GGCTGGACACTGACCTGAGGTGG + Intergenic
1175951094 20:62583758-62583780 GGATGAACACTTAGCTCAGCAGG - Intergenic
1176301287 21:5100237-5100259 GGCTGGACACGCAGGGGGGCTGG - Intergenic
1177498359 21:21918156-21918178 GGCAGGAGGCTCAGCTGAGTCGG + Intergenic
1178632158 21:34271401-34271423 GGCTGCACACTCTCCTGAGAAGG - Intergenic
1178790570 21:35695899-35695921 GTGTGGACCCTCAGCTGAGGAGG + Intronic
1179623967 21:42637845-42637867 GGCTTGAGAGTCAGCGGAGCTGG - Intergenic
1179855743 21:44161662-44161684 GGCTGGACACGCAGGGGGGCTGG + Intergenic
1179928448 21:44551293-44551315 GGCTGGACACACAGCTCACTGGG + Exonic
1179929610 21:44558550-44558572 GGCTGGACACACAGCTCACTGGG + Exonic
1179932655 21:44580431-44580453 GGCTGGACACACAGCTCACTGGG + Exonic
1179940701 21:44637546-44637568 GGCTGGACACACAGCTCACTGGG - Exonic
1179942043 21:44646602-44646624 GGCTGGACACACAGCTCACTGGG - Exonic
1179949600 21:44702339-44702361 GGCTGGACACACAGCTCACTGGG - Intronic
1180001564 21:44997636-44997658 GGCAGCACACACAGCTGTGCGGG + Intergenic
1180760225 22:18196769-18196791 AGCTGGACACTCAGCAGTGGCGG + Intergenic
1180775443 22:18427927-18427949 AGCTGGACACTCAGCAGTGGCGG - Intergenic
1181064371 22:20298781-20298803 GGCTGGATTCTCAGCCGATCCGG + Intergenic
1181963867 22:26643041-26643063 GGCTGGCCCCTCACCTCAGCCGG + Intergenic
1182661701 22:31929668-31929690 AGCTGGAGTCACAGCTGAGCTGG + Intergenic
1183012247 22:34956441-34956463 GGCTGGAGCCTCAGCCAAGCAGG + Intergenic
1183211856 22:36455953-36455975 GGGAGGACACTCAGGTGATCGGG - Intergenic
1183320918 22:37164556-37164578 GCCTGGACATTCAGGTGAGTGGG + Intronic
1185167396 22:49270086-49270108 GGCTGGGCTCACAGCTGTGCTGG + Intergenic
1185167426 22:49270220-49270242 GGCTGGCCTCACAGCTGTGCTGG + Intergenic
1185167448 22:49270288-49270310 GGCTGGGCTCACAGCTGTGCTGG + Intergenic
1185278205 22:49958953-49958975 TGCTGGACACGCAGCAGAGGTGG - Intergenic
1203278577 22_KI270734v1_random:110014-110036 AGCTGGACACTCAGCAGTGGCGG + Intergenic
949465210 3:4336706-4336728 GCCTGGGCATTCAGCTGAGCTGG - Intronic
949855419 3:8456941-8456963 GCTTGGACACTCAGGTGACCAGG - Intergenic
953040739 3:39252944-39252966 GGCAGGAGACTCAGGTGTGCAGG + Intergenic
954456629 3:50603152-50603174 GGCTGGACACACAGCTGAGTGGG - Intergenic
955348798 3:58179564-58179586 CGCTGGACACGCAGCTGAGGAGG - Intergenic
957296888 3:78344130-78344152 ACCTGGGCACTCAGCTGTGCAGG + Intergenic
957738013 3:84226964-84226986 GGTTGGAAAGTCATCTGAGCTGG + Intergenic
958748404 3:98165160-98165182 GGTCGGACACTCAGCTGGACTGG - Intergenic
962708640 3:138067888-138067910 GGCTGGATCCTCAGATGGGCAGG - Intronic
966254051 3:177898351-177898373 GGCTGTGCACTCCGCAGAGCTGG + Intergenic
966840022 3:184081036-184081058 GGCTGCGCACTCCACTGAGCAGG + Intergenic
968360333 3:198142597-198142619 GGCAGGACACTCGCCTGGGCTGG - Intergenic
968448946 4:666195-666217 GGCTGTACACAGTGCTGAGCCGG - Intronic
969132755 4:5003773-5003795 GGCTGGGGTCTCAGCTCAGCAGG + Intergenic
969389411 4:6879757-6879779 GGCTGGCTTCTCAGCTGAGCGGG + Intronic
969596424 4:8151761-8151783 GGCTGGAGACGCTGCTGGGCTGG + Intronic
972816958 4:42656201-42656223 GGCTGAAAAGTCAGCTCAGCTGG + Intronic
976570042 4:86596730-86596752 GGCTGGGCACTAAGATGAGCTGG - Intronic
976861837 4:89675003-89675025 AGTTGGACACTCAGCTGAACTGG - Intergenic
977657380 4:99537297-99537319 GGTTGGACACTCAGCTGGACTGG + Intronic
978944543 4:114479903-114479925 GCTTGGACACTCAGCTGAACTGG + Intergenic
980740629 4:136946326-136946348 GGCTGCACACTCCACGGAGCTGG + Intergenic
981655211 4:147105060-147105082 GGCTGTGCACTCAGCTGTGAGGG + Intergenic
983255610 4:165396798-165396820 GGCAGGACAATCACTTGAGCTGG + Intronic
983413995 4:167432652-167432674 GGCTGGAAGCTCAGCTGTGCAGG - Intergenic
983580265 4:169302862-169302884 GGCTGGAGACTCAGGAAAGCTGG + Intergenic
983971000 4:173874235-173874257 GGCTGTACACTCACCTGAGGAGG - Intergenic
984402565 4:179286061-179286083 AGTTGGACACTCAGCTGGACTGG + Intergenic
987181417 5:15372420-15372442 GGCTGTGCACTTAGCAGAGCTGG + Intergenic
987368896 5:17175205-17175227 GGCTGGAACCTTAGCTGGGCTGG + Intronic
987993723 5:25248281-25248303 GGCTGGCCTGTCAGCTGAGAAGG - Intergenic
991639223 5:68736875-68736897 GGCTGGACTCTCAGCTCCGTCGG - Intergenic
994066822 5:95553072-95553094 GGCTGGACAATCCACTCAGCAGG + Intronic
996959158 5:129223393-129223415 GGCTGGAGACTCACCAAAGCTGG - Intergenic
997696639 5:135866286-135866308 GGCTGGCCACTGAGGGGAGCAGG - Intronic
999344963 5:150809623-150809645 GCTTGGACACTCAGCTGGACTGG + Intergenic
1001268130 5:170289994-170290016 GGCTGGAGACACAGAGGAGCAGG + Intronic
1001517467 5:172365949-172365971 GTCTGGGCCCTCAGGTGAGCTGG + Intronic
1002085055 5:176769453-176769475 GGCTGGAGACCCAGCAGACCAGG + Intergenic
1002213055 5:177609678-177609700 TGGTGCACATTCAGCTGAGCTGG + Exonic
1004128154 6:12893906-12893928 AGCTGCACTCTCTGCTGAGCAGG + Intronic
1004321159 6:14632748-14632770 GGCAGGACACAGAGCTGAGGAGG + Intergenic
1005375839 6:25181354-25181376 GGCTGTACACTGTGCTGGGCGGG - Intergenic
1005501314 6:26431301-26431323 GGCTGGACACTTCACAGAGCAGG + Intergenic
1005582670 6:27249200-27249222 GGCTGGACAAGAAGCGGAGCTGG - Exonic
1008319319 6:50088346-50088368 AGCTGGAGACTCAGGAGAGCTGG + Intergenic
1010270553 6:73911627-73911649 GCCTGGACACTCAGCCGAACTGG - Intergenic
1010735344 6:79437556-79437578 AGCTGGACACTCACTTGAGGAGG - Intergenic
1012663180 6:101930245-101930267 GGCTGGAGAATCACTTGAGCCGG + Intronic
1012749634 6:103140827-103140849 GGCTGCACACTCCACAGAGCTGG - Intergenic
1012861046 6:104559959-104559981 GGCTGGACAGTTACCTGAGAGGG - Intergenic
1013893383 6:115054132-115054154 GGTTGGACACTCAGCAGGACTGG - Intergenic
1016748022 6:147601963-147601985 GGCTGAAGACTCAGCAGAGTTGG + Intronic
1017761818 6:157575057-157575079 GGCTGGAAAGTCAGGTGAGTTGG + Intronic
1018660042 6:166077156-166077178 GGCTGCACACTCTGTAGAGCTGG - Intergenic
1019259669 7:74035-74057 GGCAGGACACTCGCCTGGGCTGG + Intergenic
1021616542 7:22507768-22507790 GTCTGCACACTCATCTGAGAAGG - Intronic
1023942127 7:44775943-44775965 AGCTGGACACTTCGCTGACCAGG + Intergenic
1025013985 7:55424022-55424044 AGCTGGACACTCAGCCGAGAAGG - Intronic
1025022837 7:55493372-55493394 GGATGGGCACACAGCAGAGCGGG + Intronic
1026904937 7:74057465-74057487 GGCTGGAGACACAGCTCACCTGG - Intronic
1029824352 7:103173667-103173689 GTCTGCACACTCAACTGAGAAGG - Intergenic
1030360118 7:108586883-108586905 GGCTTTACAATCAGCTGAGCTGG - Intergenic
1033216215 7:139495506-139495528 GGCTGCGCATTCAGCAGAGCAGG - Intergenic
1034351107 7:150415280-150415302 GCCTGGCCACTCAGCCGAGCTGG - Intergenic
1034762925 7:153690344-153690366 GGTCGGACACTCAGCTGGACTGG + Intergenic
1035717337 8:1764070-1764092 GGCCGGGAACTCAGCTGAGGGGG + Intronic
1036937795 8:13021177-13021199 GGCTGGACTCTGAGAAGAGCTGG - Exonic
1038773061 8:30501999-30502021 GGATGGAAACTTAGCTGCGCAGG + Intronic
1039435823 8:37558711-37558733 GGCTGGGCACCAAGCAGAGCAGG - Intergenic
1040842157 8:51795768-51795790 GCCCAGACACTCAGCTGAACTGG - Intronic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1042395919 8:68292362-68292384 GGCTGGACACTCCATGGAGCCGG + Intergenic
1044081920 8:87896018-87896040 GGCTGGACATATAGCTGTGCAGG - Intergenic
1044841758 8:96343142-96343164 TGCTGGACACACAGCTGGGTGGG - Intergenic
1045738187 8:105319652-105319674 GCCAGGACGCTCAGCCGAGCGGG + Intronic
1047225586 8:122953198-122953220 GGGTGGAGACCAAGCTGAGCAGG + Exonic
1047537963 8:125736679-125736701 GGCTGGAGACCCAGGAGAGCTGG - Intergenic
1049427015 8:142542217-142542239 AGCTGGACTCGGAGCTGAGCCGG + Exonic
1049519736 8:143082019-143082041 GGCTGGGCACCCAGCCCAGCAGG + Intronic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1050451513 9:5786533-5786555 GCCTGGACCCTGTGCTGAGCTGG - Exonic
1050693966 9:8259219-8259241 GGCAGAGCACCCAGCTGAGCTGG - Intergenic
1051220114 9:14839403-14839425 GGTAGGACACACATCTGAGCTGG + Intronic
1051605599 9:18915169-18915191 GGATGGACACTCATCTGGGAAGG - Intergenic
1051710635 9:19927332-19927354 AGCTGGAAACTCAGCAGAGCTGG - Intergenic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1052707376 9:32010340-32010362 GGCTGCACACTCCACAGAGCTGG + Intergenic
1055700429 9:78938982-78939004 GTCTGGAGCCTCAGCTGAGAAGG - Intergenic
1057228799 9:93306383-93306405 GGCAGGACACCCTGCTGAGTCGG - Intronic
1061187171 9:129061333-129061355 TGCCGGACCCTCAGGTGAGCAGG + Exonic
1061811892 9:133167129-133167151 GTCTGGGAACTCAGGTGAGCAGG + Intergenic
1062071368 9:134556687-134556709 GACTCCACACCCAGCTGAGCTGG - Intergenic
1062076691 9:134593563-134593585 GGATGGAGCCTCAGCTCAGCAGG - Intergenic
1062094098 9:134694243-134694265 GTTTGGAGACTGAGCTGAGCAGG + Intronic
1062359985 9:136183090-136183112 GGCTGGGCACACAGGAGAGCAGG - Intergenic
1062745032 9:138206427-138206449 GGCAGGACACTCGCCTGGGCTGG - Intergenic
1187496334 X:19798969-19798991 GGCTGCACAGTTAGCTGAGTGGG + Intronic
1188872004 X:35383440-35383462 AGCTGTACAGCCAGCTGAGCTGG - Intergenic
1192428951 X:71099963-71099985 GGCTGGAATCTCAGCACAGCAGG - Intronic
1194824613 X:98546465-98546487 GGCTGGAGGATCACCTGAGCTGG - Intergenic
1195614923 X:106904364-106904386 GGCTGGACACTGAGGTCAGGAGG - Intronic
1196968588 X:121084688-121084710 GGTCGGACACTCAGCTGGACTGG + Intergenic
1198299596 X:135322129-135322151 GCCTGGACACTCAGCTGGACCGG + Intronic
1201575179 Y:15455509-15455531 GGTCGGACACTCAGCTGGACAGG + Intergenic