ID: 1076649052

View in Genome Browser
Species Human (GRCh38)
Location 10:131974720-131974742
Sequence ATTTCTAACGAGGTTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076649048_1076649052 23 Left 1076649048 10:131974674-131974696 CCAGCCTCTATGACTTGCATCGT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076649052 10:131974720-131974742 ATTTCTAACGAGGTTGAAGACGG No data
1076649049_1076649052 19 Left 1076649049 10:131974678-131974700 CCTCTATGACTTGCATCGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1076649052 10:131974720-131974742 ATTTCTAACGAGGTTGAAGACGG No data
1076649046_1076649052 29 Left 1076649046 10:131974668-131974690 CCATGCCCAGCCTCTATGACTTG 0: 1
1: 0
2: 7
3: 101
4: 813
Right 1076649052 10:131974720-131974742 ATTTCTAACGAGGTTGAAGACGG No data
1076649047_1076649052 24 Left 1076649047 10:131974673-131974695 CCCAGCCTCTATGACTTGCATCG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1076649052 10:131974720-131974742 ATTTCTAACGAGGTTGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076649052 Original CRISPR ATTTCTAACGAGGTTGAAGA CGG Intronic
No off target data available for this crispr