ID: 1076649798

View in Genome Browser
Species Human (GRCh38)
Location 10:131980018-131980040
Sequence GCCCTGAGTGTCCGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076649798_1076649808 15 Left 1076649798 10:131980018-131980040 CCTGCCGCGCGGACACTCAGGGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1076649808 10:131980056-131980078 CTACATGGGATCCACCCCGCGGG No data
1076649798_1076649802 0 Left 1076649798 10:131980018-131980040 CCTGCCGCGCGGACACTCAGGGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1076649802 10:131980041-131980063 GGCCCAAGGAATCGCCTACATGG No data
1076649798_1076649803 1 Left 1076649798 10:131980018-131980040 CCTGCCGCGCGGACACTCAGGGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1076649803 10:131980042-131980064 GCCCAAGGAATCGCCTACATGGG No data
1076649798_1076649807 14 Left 1076649798 10:131980018-131980040 CCTGCCGCGCGGACACTCAGGGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1076649807 10:131980055-131980077 CCTACATGGGATCCACCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076649798 Original CRISPR GCCCTGAGTGTCCGCGCGGC AGG (reversed) Intronic
900121594 1:1050664-1050686 GCCCTGGGTGGTCGCGTGGCCGG + Intronic
900157029 1:1207228-1207250 GCCCTGGGTGCCCGCGGGGGCGG - Intergenic
900569861 1:3352941-3352963 GCCCTGAGTGCCCACCCTGCAGG + Intronic
904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG + Intergenic
906702704 1:47871585-47871607 GCTCTGAGTGTGTGAGCGGCAGG - Intronic
907261282 1:53220533-53220555 CCCCTCCGTGTCCCCGCGGCGGG + Intronic
908195435 1:61742593-61742615 CCCCTGGGTGTCCCCGCGCCTGG + Intronic
911070038 1:93825247-93825269 GCTCTGAGTGTCCACTTGGCCGG + Intronic
1063956449 10:11271978-11272000 GCCCTGCGTGTCCCGCCGGCTGG + Intronic
1070329615 10:75408131-75408153 GCCCTGAGAGGCTGCGCGGGTGG + Intergenic
1076649798 10:131980018-131980040 GCCCTGAGTGTCCGCGCGGCAGG - Intronic
1088550599 11:111009055-111009077 GGCCTGAGTGTTCATGCGGCAGG + Intergenic
1091320278 11:134644671-134644693 GGCCTGAGTGCCCGGGCAGCAGG - Intergenic
1095440899 12:42238110-42238132 GCCCGGACTGTGCGGGCGGCAGG - Intronic
1102910080 12:116707042-116707064 GCCCTGAGTATTCACGCAGCAGG - Intergenic
1104008842 12:124914867-124914889 GTCCTGAGCGTCCGGGCGGAAGG + Exonic
1104845038 12:131842378-131842400 GCCGGGAGGGTCCGGGCGGCAGG - Intronic
1105223665 13:18408235-18408257 GGCCCAAGTATCCGCGCGGCTGG - Intergenic
1105801035 13:23903568-23903590 CCCCTGAGTCCCAGCGCGGCTGG + Intergenic
1105956480 13:25287599-25287621 GCCCCGCGCGTCCGCTCGGCGGG - Exonic
1116945519 14:50831457-50831479 GGCCCGAGTGTCCGCGGTGCGGG - Intergenic
1118809093 14:69260716-69260738 GCCCGGCGTGCGCGCGCGGCTGG + Intronic
1122986187 14:105212722-105212744 GCCCTGTGTGTCCGTGCTGGAGG - Intronic
1130543836 15:84840585-84840607 ACCCTGAGTGTCCGGGCGCCTGG + Exonic
1130727337 15:86452866-86452888 GCCCTGAGTGTTCCCGCTGCTGG + Intronic
1132238327 15:100238406-100238428 GCCTTGAGTGTCCCCAGGGCTGG + Intronic
1132669267 16:1096015-1096037 GCCCTGATTGTCTGCCAGGCAGG - Intronic
1132809927 16:1792613-1792635 GCCCTGAGCGTCTGTGCAGCGGG - Intronic
1133369923 16:5239679-5239701 GCCCGGCGTGTCCGCGGTGCGGG + Intergenic
1137783012 16:51113916-51113938 GCTGTGTGTGGCCGCGCGGCCGG + Intergenic
1141790377 16:86230347-86230369 GCCCAGAGTCTCCGGGGGGCTGG - Intergenic
1141839685 16:86566898-86566920 GCCCCGAGGGTCAGCGCGCCGGG - Intergenic
1144334300 17:14255303-14255325 GCCCTGAGTGGCCATGAGGCCGG - Intergenic
1146398407 17:32486450-32486472 GCCGAGAGTGCCCCCGCGGCCGG + Intergenic
1148191113 17:45679204-45679226 GCCCTGAGTGTTGGCGTGTCTGG - Intergenic
1148262074 17:46192986-46193008 GCCCTGACTTTCCGGGCGGGGGG + Intronic
1152092829 17:78256582-78256604 GCCCTGAGGGCCAGCGTGGCTGG + Intergenic
1153900576 18:9614393-9614415 GCCCTGAGTGGCTGCCGGGCCGG - Intronic
1160873109 19:1285917-1285939 GCTCCGACAGTCCGCGCGGCCGG + Intergenic
1160934003 19:1584717-1584739 CCCCTGAGGCTCCGCGCCGCCGG - Intronic
1161395268 19:4042174-4042196 GCCCTGAGGGTCCACGGTGCAGG + Intergenic
1162481391 19:10928894-10928916 GCCGGGAGTGTGGGCGCGGCTGG + Exonic
1164639334 19:29812576-29812598 GCGGTGAGTGCCCGCGCCGCGGG + Exonic
1168408067 19:56121009-56121031 GGCGTGAGTGGGCGCGCGGCCGG - Intronic
927542659 2:23926827-23926849 GCCCTGACTGACCGGCCGGCGGG - Exonic
927985777 2:27409486-27409508 GCCCCGGGGGTGCGCGCGGCAGG + Exonic
928313921 2:30231858-30231880 GCGCTGAGCGCCCGCGCCGCCGG - Intronic
930780745 2:55223452-55223474 GCCCTGAGGCTGCGCGGGGCCGG - Intronic
931728048 2:65129967-65129989 GCCCTGACTCTCCGCGCCACGGG + Exonic
934523085 2:95032165-95032187 GACCTGAGTGTGAGCGCTGCTGG - Intronic
938528732 2:132162278-132162300 GGCCCAAGTATCCGCGCGGCTGG + Intronic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
947327335 2:228992723-228992745 GCCCTGAGTGTGCACATGGCTGG + Intronic
1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG + Intronic
1174185512 20:48703421-48703443 GCCCTGAGTCTTGGTGCGGCAGG - Intronic
1176625206 21:9086905-9086927 GGCCTCAGGGTCCGCGTGGCAGG - Intergenic
1176767770 21:13037634-13037656 GGCCCAAGTATCCGCGCGGCTGG - Intergenic
1179556730 21:42183224-42183246 GCCCTGAGAGTCGGGCCGGCAGG - Intergenic
1180039172 21:45267068-45267090 GCCGTGAGCGTCCCCGAGGCCGG - Intronic
1180042667 21:45288157-45288179 CTCCTGAGGGTCCGCGAGGCCGG + Intergenic
1180075493 21:45459525-45459547 GCCCTGTGTGTCCACCCCGCCGG + Intronic
1180991809 22:19941654-19941676 GCGGTAGGTGTCCGCGCGGCCGG - Exonic
1183720319 22:39558376-39558398 GCCCGGGTTGTCCGCGCGTCCGG + Intergenic
1185050567 22:48552026-48552048 GCTCTGACTGTCCTCCCGGCAGG + Intronic
950472098 3:13192777-13192799 GCCCTGTGTGTCCACCTGGCTGG + Intergenic
957048828 3:75396321-75396343 GCCCCCGGGGTCCGCGCGGCTGG + Intergenic
961453814 3:127014639-127014661 GCCCTGGGTGTGTGCGGGGCGGG + Intronic
961569176 3:127785949-127785971 CCCCTGAGTGTCTGAGTGGCTGG + Intronic
966372108 3:179261247-179261269 GCTCTGCGTGGCCGCGGGGCTGG + Intronic
968616480 4:1579758-1579780 GCCAGGAGTGTCCGCGCTGTGGG + Intergenic
969704225 4:8783280-8783302 CCCGTGACTGTCCGTGCGGCAGG - Intergenic
978885275 4:113761147-113761169 GCCCTGGGTGACAGCGCCGCGGG - Intronic
985639590 5:1057451-1057473 GCCGTGAGTGTCCGTGCGTGTGG - Exonic
985795980 5:1962469-1962491 GCCCAGAGTGTGCGCCCAGCCGG + Intergenic
993095374 5:83473408-83473430 GCCGCGGGTGTGCGCGCGGCAGG - Intronic
1000071474 5:157744194-157744216 GCCCTGTGAGTCCGCGGGCCGGG + Exonic
1013272496 6:108557865-108557887 GCCCGGAGAGGCCGCGCCGCGGG + Intergenic
1019644339 7:2121073-2121095 GCCGGGAGTGTCCTTGCGGCTGG - Intronic
1027995730 7:85423671-85423693 GCCCTGAGTGTGCGCGCAACCGG - Intergenic
1028596068 7:92547213-92547235 GCCCTGAGTGTGCGCACACCTGG - Intergenic
1030817236 7:114052980-114053002 GCCCTGAGTGTCTACAAGGCAGG + Intronic
1034284230 7:149873884-149873906 GTCCTGAGTGACAGCGCGGCGGG + Exonic
1034423113 7:150999444-150999466 GCTCTGATTGTCCCCGTGGCTGG - Intronic
1035727024 8:1831080-1831102 GCTCTGTGTGTCAGAGCGGCTGG + Intronic
1035730236 8:1849406-1849428 GCCCTCTGTGTCCACGCGGCCGG - Intronic
1035730356 8:1849930-1849952 GCCCTCTGTGTCCACGCAGCCGG - Intronic
1035730386 8:1850062-1850084 GCCCTCTGTGTCCACGCAGCCGG - Intronic
1035770395 8:2142643-2142665 GCCCTGGGTGTCTGGGCTGCAGG - Intronic
1046674733 8:117094922-117094944 GCCCTGAGTGTGTGCACGCCTGG + Intronic
1054356907 9:64070934-64070956 GGCCTCAGTATCCGCGCTGCTGG - Intergenic
1056985676 9:91361946-91361968 GCCGTGCGCGTGCGCGCGGCAGG - Intergenic
1057313469 9:93955289-93955311 GCCCTGCGCCTCCGCCCGGCCGG - Exonic
1059354466 9:113688057-113688079 GGCCTGAGTGTGCGGGCTGCAGG - Intergenic
1059533946 9:115063833-115063855 GTCCTGAGTGACCCCGCGGATGG + Exonic
1061986902 9:134135409-134135431 GCCCTGCCAGTCCGCGGGGCTGG + Intronic
1062448094 9:136604167-136604189 GGACTGTGTGTCCGAGCGGCTGG + Intergenic
1185455951 X:311071-311093 GCCCTGAGTGTCGGTGAGGCTGG + Intronic
1189322576 X:40095776-40095798 GCTGTGAGTGCCCGCGCGCCAGG - Intronic
1200244493 X:154515918-154515940 GCCCTGCCTGGCCGGGCGGCTGG - Exonic
1201161727 Y:11172335-11172357 GGCCTCAGGGTCCGCGTGGCAGG - Intergenic