ID: 1076649798

View in Genome Browser
Species Human (GRCh38)
Location 10:131980018-131980040
Sequence GCCCTGAGTGTCCGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076649798_1076649808 15 Left 1076649798 10:131980018-131980040 CCTGCCGCGCGGACACTCAGGGC No data
Right 1076649808 10:131980056-131980078 CTACATGGGATCCACCCCGCGGG No data
1076649798_1076649802 0 Left 1076649798 10:131980018-131980040 CCTGCCGCGCGGACACTCAGGGC No data
Right 1076649802 10:131980041-131980063 GGCCCAAGGAATCGCCTACATGG No data
1076649798_1076649803 1 Left 1076649798 10:131980018-131980040 CCTGCCGCGCGGACACTCAGGGC No data
Right 1076649803 10:131980042-131980064 GCCCAAGGAATCGCCTACATGGG No data
1076649798_1076649807 14 Left 1076649798 10:131980018-131980040 CCTGCCGCGCGGACACTCAGGGC No data
Right 1076649807 10:131980055-131980077 CCTACATGGGATCCACCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076649798 Original CRISPR GCCCTGAGTGTCCGCGCGGC AGG (reversed) Intronic